Hello, i understand the question, but i only need to know which option is right, no need for explanation. thanks in advance. 7- The main difference between CDNA and genomic DNA libraries isThe presence of transcribed and non-transcribed regionsb) O The source of samplesC)The way of samplingd)The length of isolated DNA samplesBoş bırakKonek7/40Sonraki>Карat

The term genomic DNA refers to the DNA that resides in the chromosome within the nucleus that has…

7- The main difference between CDNA and genomic DNA libraries is a) The presence of transcribed and non-transcribed regions b) The source of samples The way of sampling d) The length of isolated DNA samples Boş bırak

7- The main difference between CDNA and genomic DNA libraries is a) The presence of transcribed and non-transcribed regions b) The source of samples The way of sampling d) The length of isolated DNA samples Boş bırak

Anatomy & Physiology

1st Edition

ISBN:9781938168130

Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Publisher:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Chapter3: The Cellular Level Of Organization

Section: Chapter Questions

Problem 17RQ: Which of the following sequences on a DNA molecule would be complementary to GCTTATAT? TAGGCGCG...

See similar textbooks

Related questions

Q: 18. Choose the correct number of DNA molecules created after 6 cycles of PCR. a. 6 b. 16 c. 32 d. 64…

A: Introduction The polymerase chain reaction (PCR) is a widely used method for rapidly making…

Q: Using the same template strand, transcribe the DNA: GCA TAG CAA TGC

A: Answer: Transcription : It is the process of transcribing DNA to RNA using the template strand of…

Q: 2) Explain how the polymerase chain reaction (PCR) works and how this technique can be employed to:…

A: Technology is utilized in science, while science is used in technology. Both are vital to our…

Q: 2- Supposed that you have a DNA sequence sample with 10,000 bp. By using 2 different restriction…

A: The answer is 3.

Q: 1. In gene reflection, which is part of a designated vector that cannot be part of the original…

A: Bacteria may have plasmids, which are tiny rings of DNA with a considerably lesser amount of genes.…

Q: explain the rationales of adding chemicals that can affect DNA stability in a polymerase chain…

A: PCR is the polymerase chain reaction that use to amplify the particular sequence of DNA and forming…

Q: 1. Indicate the objective of this method..... of the DNA 2. Pick out the donor...... & the…

A: Hello. Since your question has multiple sub-parts, we will solve the first three sub-parts for you.…

Q: What the most important components a recombinant plasmid must have? (Keywords: gene of…

A: Plasmids are extrachromosomal self replicating closed circular DNA present in bacterial cell. They…

Q: 1. You are having problems getting good transfection efficiency when you put your plasmid in e.…

A: Transfection is the process of deliberately introducing naked or purified nucleic acids into…

Q: (iij If one of the strands of DNA has the following sequence of bases running in the 5'3' direction…

Q: 20. Which of the following are characteristics of bacterial plasmids? a. Useful cloning vectors b.…

A: The plasmid is an extrachromosomal DNA in bacteria located in the cytoplasm of an organism.…

Q: 3. Which of the following statement is FALSE about CRISPR? A. The size of CRISPR locus is usually…

A: Introduction CRISPR stands for clustered regularly interspaced short palindromic repeats, and it is…

Q: 3.Write the role of each of the following substances in the DNA extraction (Hint: page 98 of the lab…

A: a) Role of alcohol in DNA extraction DNA is soluble in water and insoluble in alcohol, so alcohol is…

Q: 9. Why does the lagging strand need Ligase? * O Polymerase runs 5' to 3'. This creates fragments and…

A: Replication is the process which is responsible for producing daughter DNA molecules from the…

Q: 4. Write the Edman degradation technique used for the sequencing of proteins

A: “Since you have asked multiple questions, we will solve the first question for you. If youwant any…

Q: You have a DNA sequence of 1400 bp. To characterize it, you decide to make a restriction map.…

A: DNA is a nucleotide polymer present in living beings.

Q: . Illustrate the basic steps in DNA extraction

A: The genetic material that is densely packed inside the nucleus and chromosomes is known as DNA. The…

Q: Explain how and why a researcher might use a DNA probe.

A: Probes , DNA probes -- Segments of DNA or RNA with the help of which cDNA or RNA segments of any…

Q: 11.Fill out the following table by adding the complementary RNA and DNA basses. NA NA А G C

A: Answer: Nucleic bases are the nitrogen containing compounds such as adenine , guanine , thymine ,…

Q: 1. Use the plasmid shown to complete the table. # of Fragment Sizes Restriction Enzyme Used…

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: 1/ Why is Thermus aquaticus so useful: O t is necessary for the mass production of bacteria…

A: Given: Thermus aquaticus is a thermophillic bacteria.It belongs to family thermaceae.Thermus…

Q: 6) In automated DNA sequencing a) Radio labelled DNTPS are used b) Radio labelled ddNTPs are used c)…

A: “Since you have posted multiple questions, we will provide the solution only to the first question…

Q: 9. Estimate the sizes of the bands, in each of the lanes for the gel attached below. Then, for each…

A: A restriction endonuclease or restriction enzyme is a bacterial enzyme that cuts dsDNA into…

Q: _1. Bacterial proteins that have the ability to cut both strands of the DNA molecule at certain…

A: DNA and RNA are the two main forms of nucleic acids. Nucleotides, which have a five-carbon sugar…

Q: 1. What is the purpose of recombinant DNA technology?

A: Since you have posted multiple questions, we will do one question for you. If you need any specific…

Q: 8- Briefly state why heat-stable DNA polymerase from a thermophilic bacterium is used in PCR instead…

A: Polymerase chain reaction is the method of multiplying an specific sequence of dna to obtain it's…

Q: 1) Follow the steps involved in DNA or gene cloning

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: A. What is the relationship between the DNA molecular weight and the distance travelled by DNA…

A: DNA is a genetic material and compose of nucleotide bases, ribose sugar and phosphate. It is used in…

Q: 1 DNA evidence analysis is an imperfect science. Provide two reasons why this may be the case.

A: DNA is the hereditary material present in organisms. It is important for our growth, reproduction,…

Q: 8. Describe the steps involved in the process of genetic engineering via recombinant DNA technology.…

A: Recombinant DNA TechnologyRecombinant DNA technology alters the phenotype of an organism (host)…

Q: 5. Bacteriophages' genomes are typically composed of A) double-stranded DNA. B) double-stranded RNA.…

A: Ps :- don't confuse bacteria with bacteriophage. A bacteriophage is a type of virus. And as you…

Q: 22. Which statement is correct about restriction enzyme? O They cut methylatedsite O They cut…

A: A restriction enzyme detects a certain short nuclear sequence and specifically breaks DNA at that…

Q: The Southern blot procedure was developed số that: DNA fragments that have been subjected to…

A: Answer 1) : Option " 1 " is correct : DNA fragments that has been subjected to electrophoresis…

Q: 11) How would an organism be impacted by an error in the mRNA sequence? A) DNA would not be…

A: An error in the sequence always results in the wrong aminoacid being produced. Hence option(c) is…

Q: 9. Five DNA samples are shown along with their recognition sites where a particular restriction…

A: Gel electrophoresis Gel electrophoresis is a molecular technique that involves the separation of DNA…

Q: 1. What is a plasmid? How are they used in bioengineering?

A: Answer : plasmid is the molecule which is known as the extrachromosomal molecule that is present in…

Q: What is the name of the process by which bacteria pick up a different organism’s genetic material?

A: 4. A bacterium takes up a fragment of DNA circulating in its surroundings during transformation. A…

Q: 1. What is the principle behind the DNA extraction? 2. Describe the features isolated DNA of…

A: Hi, thank you for posting your question on Bartleby. As per the guidelines, we can answer only one…

Q: 1- Depending on the enzymatic method in DNA isolation, What is the defending mechanism of our eyes…

A: During DNA replication, the complete double helix of DNA is gradually unwound, resulting in…

Q: 3- Which of the following is not a basic requirement of PCR? a-Taq DNA polymerase b-DNA Probes…

A: Polymerase Chain Reaction (PCR). Principle: When a double-stranded DNA molecule is heated to a high…

Q: 1. List all the differences between the DNA Polymerase Reaction and Polymerase Chain Reaction (PCR)?

A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…

Q: What is the purpose of restriction enzyme? 2. What is the purpose of the probe in DNA finger…

A: Since you have posted a question with multi- sub parts , we will solve first three sub-parts for…

Q: Describe a certain species to use to for recombiant plasmids and explain what recombinant plasmids…

A: The most common species to be utilised for Recombinant Engineering is Escherischia Coli. It has been…

Q: a. Genome Project-write b. Mitochondrial DNA 'Spring Cleaning' c. Micro-encapsulation с. d. Specific…

Q: . Describe and list the steps involved in DNA replication. 2.

A: DNA is a molecule made up of two polynucleotide chains wrapped around each other to form a…

Q: Explain the importance of Isolating DNA from the cells of organisms.

A: DNA is the genetic material for most organisms. The methods used to isolate DNA are dependent on the…

Q: Make simple steps to extract isolating DNA from strawberries and yeast.

A: Answer

Q: DNA was extracted from a bacterial species. The proportion of cytosine was found to be 30%, then…

A: There are four nitrogenous bases present in the DNA molecule. These are adenine, guanine, thymine,…

Concept explainers

Violence

Violence is defined as a physical act that causes or is intended to cause harm. Violence can cause physical, emotional, or both types of harm. Violence is defined by the World Health Organization as the intended use of physical force and power that causes threat or harm against oneself, another person, or against a community or group, and has the potential to cause damage, death, mental distress, maldevelopment, or poverty.

Question

Hello, i understand the question, but i only need to know which option is right, no need for explanation. thanks in advance.

7- The main difference between CDNA and genomic DNA libraries is
The presence of transcribed and non-transcribed regions
b) O The source of samples
C)
The way of sampling
d)
The length of isolated DNA samples
Boş bırak
Konek
7/40
Sonraki>
Карat

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

2. Here is the detailed view of the MCS of the PUC19 plasmid: Sma I KpnI SbfI PstI SacI XbaI ECORI BamHI Sall SphI HindIII agt GAATTCGAGCTCGGTACCCGGGGA TCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGcgtaatcatggtcat 400 410 420 430 440 450 460 ...S N S SP VR PDEL TS R CAH LS P T IM T M lacZa translational start Figure 25: MCS of PUC19 A. If the MCS were cut with Kpn I and BamH I, draw the small fragment of DNA that would be cut out. Show both strands. For reference, here are the recognition sequences: 5' G|GAT СС 3' 3' С СТАG|G 5' recognition sequence for BamH I 5' G GTAC|C 3' 3' cl CATG G 5' recognition sequence for Kpn I Figure 26: recognition sequences for BamH I and Kpn I
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Which of the following sequences on a DNA molecule would be complementary to GCTTATAT? TAGGCGCG ATCCGCGC CGAATATA TGCCTCTC
EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .
a) Explain semi-conservative modelmof DNA replication b) discuss initiation in DNA replication and explain why it is a tightly controlled process.
Chimeric DNA true are all except - a) Formed by linking DNA fragments of unrelated 2ood l v genome b) Sticky end producing restriction endonucleases favour formation of chimeric DNA c) They don't require DNA ligases d) The organism harbouring a chimeric DNA has features of themselves and the properties of the insert
4. Animation 12.4: This table shows results from a genetic test conducted on DNA samples from two patients. The patients are a newly married couple seeking genetic counseling about their risks of passing on a genetic disease to any children they may have in the future. The samples included the DNA region including and immediately surrounding a single gene. Restriction enzyme cleavage analyses were performed on the samples. Female Patient 1) 3400 bp fragment Male Patient 1) 1600 bp fragment 2) 1800 bp fragment 3) 3400 bp fragment DNA fragments on gel What do the genetic test results indicate about this case? O Both the woman and the man are homozygous for the mutation. O Both the woman and the man are heterozygous. O The woman is homozygous for the mutation and the man is homozygous for the normal gene. O The woman is homozygous for the mutation and the man is heterozygous.
4) Consider the following double-stranded DNA molecule: Complementary Strand: ATGTGTAGTGCGAGTTGA Template Strand: TACACATCACGCTCAACT a) What would be the amino acid sequence coded for by the template strand of the DNA molecule above?
#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Explain the following statement : a) initiation of bacteriall DNA replication is an energy requiring process b) bacterial DNA polymerase can enter the termination sequence but cannot exis
#1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
1. (a) What will be the mRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA Template 3 - ATTGCGGATGCCCGTATACG -5 3 - AUUGCGGAUGCCCGUAUACG -5 5 - AUUGCGGAUGCCCGUAUACG -3 5 - AUUGCGGAUGCCCGUAUACG -3 3 - UAACGCCUACGGGCAUAUGC -5 (b) What will be the anticodons that will arrive in the translation of mRNA below? mRNA 5 - AAUAUGCGGAUGCCCGAA -3 "AAU, AUG, CGG, AUG, CCC, GAA" "UAC, GCC, UAC, GGG, CAA" "AUG, CGG, AUG, CCC, GAA" "UUA, UAC, GCC, UAC, GGG, CAA"