A new enzyme (protein) that helps protect a bacterial cell from reactive oxygen species (causing oxidative stress) has been discovered. It can be expected that the gene that codes for this enzyme will be expressed in phase of growth. order to make the enzyme in the O lag Not very likely. They just got transferred to fresh new medium, how much stress can they be under? O stationary O late log O log
Q: In maize, A and Bgenes are linked at 12 cM apart. If a plant of AblaB is selfed, what proportion of ...
A: Introduction :- A gene is a basic unit of heredity in biology, consisting of a sequence of nucleotid...
Q: 8. Which type of blood cell is affected in sickle cell anemia? How does the number and appearance of...
A: Sickle cell anemia is one of the group of disorders known as sickle cell disease. This disorder affe...
Q: Define thoracolumbar division
A: The sympathetic nervous system is a component of the autonomic nervous system that is responsible fo...
Q: engineer resistance into crop plants
A: A crop is a plant or plant product that can be grown and harvested for profit or subsistence.
Q: DISEASE CAUSATIVE ORGANISM VECTOR
A: Causative organism or agent in infection are pathogens. vector is a quantity or phenomenon that has...
Q: uestion 2 Match the type of transport in plants: + Through cell walls and spaces between cells A. Tr...
A: Transportation is a necessary, natural, and physiological activity that happens in all higher creatu...
Q: According to Atterberg, between the ________________ and ______________ limits, a soil is in a plast...
A:
Q: "The deeper within the dermis or subcutaneous tissue any dark pigment is located, the bluer the pigm...
A: An organ system that composed of skin, exocrine gland, nails, and hair is referred to as an integume...
Q: A footwear company wants to test the effectiveness of its new insoles (soft insole and air-fill inso...
A: Various forms of study designs are there that can be used by researchers in order to obtain evidence...
Q: Male Hormones and Their Pancaiors Direction, Match coluan A to column B. A B 1. Luteinizing hormone ...
A: A B 1. Luteinizing Hormone (LH) Y. Stimulates the secretion of sex hormones. 2. Follicle-Stimula...
Q: Discuss the structure and functions of a cell membrane comprehensively
A: Introduction "A cell is the smallest, most fundamental unit of life, responsible for all of life's o...
Q: D. Entamaeba gingivalis E. Endolimax nana F. Entamoeba dispar
A: Note: As Per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: A ...
Q: What are the advantages of applying a fungicide to seeds? Would it be better to apply a contact fung...
A: The prospective performance of a seed batch is defined by seed quality. Seed quality is affected by ...
Q: communication. Communication between two plant cells • Communication between two immune-system cells...
A: A.. Communication between two plant cell is cell to cell combination, with help of plasmodesmata B....
Q: In secondary growth, grows inward towards the middle of the stem, and grows outwards towards the edg...
A: The majority of plants have the capacity to grow throughout their life, which is in contrast to an...
Q: your own words, please answer the question. It is a fact that insects are widely distributed in any...
A: Insects are the group of organisms belonging to the Phylum Arthropoda. some insects are causative ag...
Q: 1999 Question #2 Communication occurs among the cells in a multicellular organism. Choose three of t...
A: Communication between two immune cell system is autocrine signalling where releaser itself is an acc...
Q: Describe active transport across the plasma membrane marking note of concentration gradient Nd energ...
A: Cellular transport is a very important phenomena that occurs inside the cell because there are a lot...
Q: Pollution is irresponsible action How did pollution b Directions:
A: Pollution -- Pollution is not a new phenomenon and is the greatest problem facing humanity and leadi...
Q: . In pea plants, flowers can be purple (dominant allele, A) or white (recessive allele, a). If 75% o...
A: In pea plants, the dominant allele (A) gives flowers a purple color in both homozygous and heterozyg...
Q: Your client, Robert, came back from maximal graded exercise testing and told you that his clinical e...
A: Introduction: The greatest rate of oxygen consumption measured during incremental activity, that is,...
Q: Using a diagram, outline the processes of the best DNA technology tools/techniques involved in the d...
A: A novel tool for the detection of BCR/ABL fusion gene in chronic myelogenous leukemia (CML) was deve...
Q: Does resulting daughter cells in mitosis and meiosis will have identical features with their parent ...
A: Answer 1- No. Meiosis is the process through which daughter cells are formed in sexually reproducing...
Q: Three genes in fruit flies affect a particular trait, and at least one dominant allele of each gene ...
A: The genotype is the collection of genes in our DNA that are responsible for a specific trait. The ph...
Q: _________3. It is microbial organisms that has a gene that makes plants resistant to herbicides. A...
A: Introduction Herbicides are crop-protecting agents that are used to kill weeds or disrupt normal pla...
Q: What benefit does parental care for eggs provide? What are the consequences
A:
Q: Choose one example of pseudoscience (Bigfoot, ghost hunting, homeopathy, phrenology, visions, astrol...
A: Homeopathy is a medical approach founded on the principle that the body has the ability to heal itse...
Q: How do protozoa reproduce? Give 1 example for each type.
A: Introduction Protozoa are eukaryotic single-celled creatures that belong to the kingdom Protista.
Q: This is compact bone, please use ARROWS to identify the following: osteon lamella lacuna canaliculi...
A:
Q: _________4. It is a bacterial that contains plasmid use to produce desirable proteins for human con...
A:
Q: In which ways does the limb orientation of "advanced" tetrapods differ from that of "primitive" tet...
A: Tetrapods are the four limbed structure.And these limbs have derived from fins.The limbs of all tetr...
Q: This case study is used to help illustrate the respiratory content you have been studying. It will a...
A: #Chronic bronchitis- This the long term inflammation of bronchi. This is common caused in chain smok...
Q: - What is e-waste? - Why is e-waste hazardous? - What practical ways can you maximize your e-waste...
A: What is E-waste? E-waste stands for Electronic waste. Any electronic item such as gadgets, equipmen...
Q: Describe five strategies that can be used to engineer resistance into crop plants. Which strategy do...
A: Introduction The main unit of study in agroecology is the agroecosystem, which is vaguely defined as...
Q: A. Entamoeba hartmanni B. Entamoeba coli C. Entamoeba polecki
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: A c...
Q: Variations in Animals 1. Sex differences in D. melanogaster chickens (rooster and hen) Features Male...
A: ANSWERS
Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)...
A: Central Dogma: It is the complete procedure of replication, transcription, and translation of DNA. T...
Q: 6. apply the laws of probability to statistically analyze the outcomes of genetic crosses
A: Probabilities are mathematical measures of the possibility of something happening. The empirical pro...
Q: Why do we need to assess the potential hazards in your community?
A: The term community is associated with the gathering of living organisms that can be found in a parti...
Q: Another scientist wants to generate an organism where glycolysis and the TCA cycle occur in the same...
A: Mitochondria are membrane-bound cell organelles that generate most of the chemical energy needed to ...
Q: Using the community assembly theory, provide a framework or explanation on: How do some exotic speci...
A: Community Assembly theory states that the composition and relative abundance of species within a def...
Q: 1. Consider a locus having two alleles Aj and A2, If the homozygote A¡A¡ and the heterozygote A¡A2 h...
A: Frequency of an allele refers to how frequently a particular allele appears in a population.
Q: Q6. This figure shows the sequence alignment of five (5) different Src homology 2 (SH2) domains, all...
A: sequence alingment is the method of comparing the similarities between the biological sequences pre...
Q: 10 pros and cons of stem cells as way of treating diseases nowadays.
A: Introduction :- Stem cells are cells that have the ability to differentiate into a variety of variou...
Q: Student Exploration: Identifying Nutrients Vocabulary: carbohydrate, disaccharide, lipid, monosaccha...
A: Food consists of various nutrients that provide us energy to perform work and along with this it pro...
Q: Kindly help, I don't understand this topic :(( In each of the following DNA sequences, write the co...
A: Introduction :- The genetic code is a set of laws that define how DNA's four-letter code is translat...
Q: nswer is anaerobic respiration similar to glycolysis. Provide three reasons to justify your answer. ...
A: The process by which organisms combine oxygen with foodstuff molecules and produced the chemical en...
Q: Give a) 3 examples of biotic components b) 7 examples of abiotic components
A: Biotic refers to the living components of an ecosystem and abiotic refers to the non-living componen...
Q: Define glucocorticoid
A: The endocrine system is a chemical messenger system in which hormones are delivered directly into th...
Q: cite a situation where this environmental principles can be applied. All forms of life are importan...
A: Yes for biodiversity equivalence, due to dependancy from each other All forms of life are important.
INTRODUCTION
Bacterial growth curve
Represents number of living cells in a bacterial population over a period of time.
Step by step
Solved in 2 steps
- An E. coli cell is taken from a medium contaning abundant glucose and placed in a medium containing only lactose. What will happen to the growth curve?- O A new lag phase will begin as new enzymes are produced The cells will enter the stationary phase because E. coli can not metabolize lactose The log phase will get faster, because lactose is a better nutrient for E. coli The log phase will not change, because they are both carbohydrates A Moving to the next question prevents changes to this answer.The graph represents the growth rates of different types of bacteria labeled w-z at different temperatures. -10 0 10 20 30 40 50 60 70 80 90 100 110 Temperature (°C) Lactic acid bacteria are type x. They are used in the preparation of fermented food products. What will be the impact on the lactic acid bacteria when the temperature is increased to 60°C? O These bacteria will become type y. O These bacteria will work more effectively. O These bacteria will work at the same speed. O These bacteria will stop fermenting food. Growth Rate of BacteriaWhich one of the terms below is NOT a stage in the typical growth curve of a bacterial cell under ideal conditions in culture? O Exponential phase Lag phase Stationary phase Leg Phase Death Phase
- Why does a one-step growth curve differ in shapefrom that of a bacterial growth curve?Bacteria growth and multiplication play a role in infectious diseases : Bacteria can increase in their number by binary fission into two daughter cells. The rate of exponential growth of a bacterial culture is expressed as generation time, how can the growth curve effect on generation time bacterial?This is a drawing of a Giardia cell. It has flagella, two nuclei and vacuoles. flagella vacuoles nuclei What effect would the following inhibitors have on this organism? A microfilament inhibitor would... A microtubule inhibiotor would... stop cell motility have no effect on cell motility
- Your lab coordinator has decided to grow and maintain a sourdough starter. A sourdough starter is a live, on-going culture of yeast that is grown in flour, water, and a bit of sugar. It is used as an ingredient in some types of bread. Initially when the ingredients were mixed together the mixture appeared dead. After a while, it began to bubble and foam and then it tripled in volume. Eventually it stopped bubbling. Every week it is maintained by "feeding” it fresh flour every week. Over time, it will start to develop a 'sour' taste when it is used to make bread. This is the question Sometimes the starter (which is a living culture) accumulates other species of yeast. How does it accumulcate another species? You have been asked to take this mixed culture and isolate the different species in the starter (which is basically a liquid culture). How will you do it?Which of the following is true about the organism which grew at both 37°C and 4°C in the figure below? 4°C 37°C 64°C 25°C This organism will not survive in the human body O The organism can be propagated through refrigerated food O Heating food to 350 degrees Fahrenheit (or 176 degrees C) in the oven will not kill the microorgansim The organism can grow in the human bodyYour lab coordinator has decided to grow and maintain a sourdough starter. A sourdough starter is a live, on-going culture of yeast that is grown in flour, water, and a bit of sugar. It is used as an ingredient in some types of bread. Initially when the ingredients were mixed together the mixture appeared dead. After a while, it began to bubble and foam and then it tripled in volume. Eventually it stopped bubbling. Every week it is maintained by "feeding” it fresh flour every week. Over time, it will start to develop a 'sour' taste when it is used to make bread. This is the question A sourdough starter is "fed" flour and water every week to keep it alive.Each week, some of the starter can be removed and used for baking bread.It is added to bread dough to add flavour. The older the starter, the stronger the flavour. What causes the 'sour' taste?
- Your lab coordinator has decided to grow and maintain a sourdough starter. A sourdough starter is a live, on-going culture of yeast that is grown in flour, water, and a bit of sugar. It is used as an ingredient in some types of bread. Initially when the ingredients were mixed together the mixture appeared dead. After a while, it began to bubble and foam and then it tripled in volume. Eventually it stopped bubbling. Every week it is maintained by "feeding” it fresh flour every week. Over time, it will start to develop a 'sour' taste when it is used to make bread. Question After it was mixed together and incubated, why did it eventually stop bubbling? Give two potential reasons.When bacteria are grown under adverse conditions, i.e., in the presence of a poison such as an antibiotic, most cells grow and proliferate slowly. But it is not uncommon that the growth rate of a bacterial culture kept in the presence of the poison is restored after a few days to that observed in its absence. suggest why this may be the case.When would you expect to see the E. coli produce the enzyme beta galactosidase if the growth media contained only glucose as an energy source?