a protein with a molar mass of 3800 g/mol is given. determine the number of nucleotides contained in the gene that encoded this protein, knowing that: 20% of it are introns, the mass of a nucleotide is 300 g/mol and the mass of an amino acid is 110 g/mol

a protein with a molar mass of 3800 g/mol is given. determine the number of nucleotides contained in the gene that encoded this protein, knowing that: 20% of it are introns, the mass of a nucleotide is 300 g/mol and the mass of an amino acid is 110 g/mol

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Related questions

Q: 4. Draw a chemical mechanism (with electron-pushing arrows) for how glycine is added to a…

A: Ribosomes are protein-RNA complexes that catalyse peptide bond formation. A peptide bond is formed…

Q: Which is true of reducing disaccharidess: a) One sugar has an unlinked anomeric carbon b) the…

A: Since you have posted multiple multiple choice questions, we will provide the solution only to the…

Q: (a) The diagram below on the right-hand side illustrates the polar Asp(a94)... Asn (102) interaction…

A: A table summarizing the characteristics of many hemoglobin mutants affecting the 94 position is…

Q: Which of the following is the a-anomer? H но H Но H2C H ОН H2C- нн ОН со 4 1 2 1 Submit 3 -OH Н ОН…

A: Alpha anomer

Q: The sugar molecule shown below is the cyclic form of a/an carbon is in the position. HO-CH2 O H H OH…

A: In the carbohydrate chemistry, the diastereomers differing only at the hemiacetal or acetal carbon…

Q: 8. For the following molecule, draw the monomers *Hint* there are three different monomers a. What…

A: Monomers are defined as simple units which undergo polymerization to form large and complex…

Q: Which of the following amino acids are aromatic in nature? Select the correct response(s): F [1 H K…

A: The building blocks of proteins are amino acids. They have three groups: an amino group, a carboxyl…

Q: Assume that the complete combustion of one mole of fructose, a monosaccharide, to carbon dioxide and…

A: ∆G°' = -2810 kJ/mol∆G°'compound x = -38.1 kJ/mol Moles =?

Q: You identify a section of 2 beta strands in a protein crystal structure. When you identify the…

A: The linear arrangement of amino acids in beta strands, an usual secondary structure in proteins,…

Q: During our experiment, Sucrose tested positive for Benedict's Test. Benedict's test us actually a…

A: There are four classes of biological macromolecules- nucleic acid, proteins, lipids and…

Q: For a reaction that proceeds spontaneously from reactants to products, the AG is O less than 0 00 O…

A: Gibbs Free Energy is a thermodynamic function that not only is related to spontaneity but also deals…

Q: Complete the statement to make it true. Cold blooded animals modulate the fatty acid composition of…

A: Cold-blooded animals, also known as ectothermic animals, rely on their environment to regulate their…

Q: Amino acids at the interaction site ( F,I and L) and its G protein partner (P, L, Y) are very…

A: GPCRs are also known by the name of G Protein Coupled Receptors. These are integral membrane…

Q: Wild-type Mutant 1 Mutant 2 Mutant 3 Stop silent DNA 3 CTT 5 5 3 5 Val missense 3CTC 5 5 GAG 3 mRNA…

A: The genetic code is the set of rules used by living cells to translate information encoded within…

Q: What is the process of beta oxidation

A: Beta-oxidation is a metabolic process that occurs in the mitochondria of cells and is responsible…

Q: Can you explain the various options and how did you come to the answer? How to know whether histine…

A: The proteins are constituted of 20 naturally occurring amino acids.Histidine is an essential amino…

Q: If the brain needs glucose, then gluconeogenesis stops after reaction (9, 8, 10, 2) because…

A: Gluconeogenesis is synthesis of glucose from non-carbohydrate precursor molecules such as glycerol,…

Q: 1a. If you wanted you could take a glucose molecule and convert it to pyruvate via glycolysis and…

A: Hello! Due to time constraints, we are able to provide the answer for the first sub part only. If…

Q: Adenosine triphosphate (ATP) is the main energy currency used in cells. ATP hydrolysis is coupled…

A: The structure of ATP comprises of a nucleoside triphosphate, consisting of a nitrogenous base…

Q: An alpha-helix transmembrane protein has 35 amino acid residues embedded in a lipid bilayer…

A: The repeating unit of an alpha-helix is the helix turn. Each helical turn in alpha-helix has an…

Q: 2.(a) The two diagrams on the right compare O2 binding pro- perties of Hb Kariya, a human hemo-…

A: Here we are given the hill plot for analyzing the binding kinetics of 2 hemoglobin (Hb) variants,…

Q: Would you expect any of the side chains in the peptide above to undergo hydrolysis? Select all that…

A: Hydrolysis is the cleavage of covalent bond by adding elements of water to it. A peptide is a short…

Q: As a result of the rotation about its six bonds, DNA can exist in a variety of forms. Determine…

A: There are 3 major DNA variants. They are A-DNA, B-DNA and Z-DNA. In all these variants, A pairs…

Q: A peptide in a solution with a pH of 7 has the following sequence: K-R-E-D-H-D-E…

A: The isoelectric point (pI) is the value of pH at which molecule carries no charge or the net charge…

Q: Molisch Test

A: Carbohydrate analysis:This analysis involves the following tests to identify and characterize…

Q: trypsin Enter your answers separated by a comma(s). Name peptides using the one-letter…

A: There are four classes of biological macromolecules: proteins, nucleic acids, lipids and…

Q: Which of the following stretches of RNA is most likely to form a hairpin with 4 bases making up the…

A: A nucleotide (pentose sugar + nitrogenous base + phosphate group) is a phosphoric acid ester of a…

Q: A contributing factor to the development of arthritis is the inappropriate proteolytic destruction…

A: An assay is a biochemical lab procedure to determine the quantity of molecules of interest in a…

Q: The effect of an inhibitor on an enzyme was tested and the experiment gave the results below. If…

A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…

Q: Coenzyme A, NAD+, and FAD are coenzymes that are necessary for energy production. Determine whether…

A: NAD+, FAD and Coenzyme A are all coenzymes that serve specific roles in different metabolic…

Q: Imagine you are able to incorporate a heavy isotope into the atoms of both strands of double…

A: Replication is a process wherein a daughter strand is synthesized using the parent's DNA strand. One…

Q: Assume a fragment of two-stranded antiparallel β-structure is 3.3 nm long. What is the approximate…

A: Deoxyribonucleic acid also known as DNA, is a molecule that houses the genetic instructions required…

Q: iven the kinetics data for each enzyme in the presence and absence of its inhibitor, determine the…

A: A competitive inhibitor competes with the substrate for active site of an enzyme. If inhibitor…

Q: A protein has binding affinity for its ligand of KA = 2 x 105 1/M at pH 5.0 and room temperature. a.…

A: Kd is the dissociation constant for a protein-ligand complex that measures the affinity with which a…

Q: 1. You are studying the kinetic behavior of the enzyme aldolase, which converts the substrate,…

A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…

Q: Place all eight of these steps of the insulin signaling pathway in the correct order. The…

A: One essential biological mechanism controlling glucose absorption and metabolism is the insulin…

Q: Complete the sentences describing membrane lipids by moving the names of the lipids to the…

A: There are four types of biological macromolecules: nucleic acids, proteins, lipids and…

Q: Which of the following are roles of the distal histidine in hemoglobin? to help to keep the heme in…

A: The distal histidine in hemoglobin plays a crucial role in its functioning. Let's analyze the…

Q: A scaffold protein can serve as a platform to accommodate a collection of enzymes involved in…

A: Scaffold proteins can serve as a platform to accommodate multiple enzymes involved multi-step…

Q: Glucagon is a hormone that is released when the level of glucose in the blood is low. Glucagon uses…

A: Glucagon is secreted by the α cells of pancreas.Glucagon is a hormone that helps to regulate blood…

Q: 6. List the main similarities and differences between transposons, retrotransposons, group II…

A: Retroviruses are RNA viruses that use reverse transcriptase to convert their RNA genome into DNA…

Q: results from hydrogen bonding between the backbone constituents of the overall shape of a…

A: There are four classes of biological macromolecules; nucleic acid, proteins, lipids and…

Q: Which of the following will result from the binding of one O₂ to a molecule of hemoglobin? the…

A: When one molecule of oxygen (O2) binds to a molecule of hemoglobin, it triggers specific…

Q: Suppose that each ß-adrenergic receptor bound to epinephrine converts 100 molecules of the Ga…

A: Biochemical signal transduction pathways taking place within lifeforms have the ability to amplify…

Q: Which of the following is/are true regarding SDS-PAGE (there may be more than one correct answer,…

A: SDS-PAGE is the abbreviation for Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis.It is a…

Q: Assume a protein is composed of 120 amino acid residues and that each amino acid can have three…

A: A protein's biological function depends on its three-dimensional structure. The 3D structure is…

Q: Specific rotation of L-alanine [(+)alanine) in water (at 25 °C) is +2.8. Suppose you have 2.00 g of…

Q: Name the enzyme that catalyzes the reaction shown in the figure. -Glu-Cys-Gly Glu -Cys- -Gly + NADPH…

A: Reactive Oxygen Species (ROS) can go onto extensively oxidize different components of a cell,…

Q: Out of starch, glycogen, cellulose and chitin, carbohydrate polymers with beta linkages are O…

A: The alpha and beta linkages are types of glycosidic linkages which are formed between the hemiacetal…

Q: Frog muscle cells and the solution bathing the cells contain ions at different concentrations. The…

A: Inside the cell, the most abundant ions is K+ (potassium). Therefore for the calculation of membrane…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

Definition Definition A complex molecule that makes up a fundamental unit of a DNA or RNA molecule. Nucleotides are composed of a sugar, a nitrogenous base, and a phosphoric acid.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: Protein synthesis in brief

VIEW

Step 2: Calculation to solve for the number of nucleotides contained in the gene

VIEW

Solution

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

The mass of mRNA that has copied a segment of DNA is 36,000 units, the mRNA is placed in the ribosome and represents 60% of it. Determine the mass of the protein encoded by the gene, if the mass of the amino acid is 110 and the mass of the nucleotide is 300.
The mass of RNA that has copied a segment of DNA is 63,000 units. The RNA mass that is placed in the ribosome represents 60% of it. Determine the mass of the protein encoded by the gene, if the mass of the aminoacid is 110 and the mass of the nucleotide is 300.
The genetic information contained in DNA consists of a linear sequence of coding units known as codons. Each codon consists of three adjacent DNA nucleotides that corresponto a single amino acid in a protien. The E.coli DNA molecule contains 4.70 x 10^6 base pairs. Determine the number of codons that can be present. Assuming that the average protein in E.coli consists of a chain of 400 amino acids, calculate the maximum number of protiens that can be coded by an E.coli DNA molecule.
Suppose that there is an unknown protein that underwent Edman sequencing method. From N- terminal determination, a biochemist found out that there are two N-terminal amino acid residues, V and G. What is the original sequence of the protein given the following peptide fragments: after digestion with Chymotrypsin: G-L-S-R-G-M-w V-A-L-F Q-L-Y L-R-V-W G-M-V-E-A-D-I-P K-S-P-E-M-T-W R-M-A-S-E-K-P-G-H after digestion with Trypsin: P-G-H V-W-G-M-V-E-A-D-I-P M-A-S-E-K G-M-W-Q-L-Y-L-R S-P-E-M-T-W-R G-L-S-R V-A-L-F-K after digestion with Cyanogen Bromide: T-W-R-M W-Q-L-Y-L-R-V-W-G-M V-E-A-D-I-P A-S-E-K-P-G-H V-A-L-F-K-S-P-E-M G-L-S-R-G-M
The E. coli DNA molecule contains 4.70 x 105 base pairs. Determine the number of codons that can be present in this DNA molecule. number of codons: 1.57 x106 codons Assuming that the average protein in E. coli consists of a chain of 420 amino acids, calculate the maximum number of proteins that can be coded by an E. coli DNA molecule. number of proteins: proteins
A portion of the sequence from the DNA coding strand of the chick ovalbumin gene is shown. Determine the partial amino acid sequence of the encoded protein. CTCAGAGTTCACCATGGGCTCCATCGGTGCAGCAAGCATGGAA-(1104 bp)-TTCTTTGGCAGATGTGTTTCCCCTTAAAAAGAA Enter the 3-letter abbreviation for each amino acid in sequence, separated with dashes, and no spaces (example: xxx-xxx-XXX-XXX...) The amino acid sequence is .1104bp..…........
The protein encoded by the cystic fibrosis gene is 1480amino acids long, yet the gene spans 250 kb. How is thisdifference possible?
Lactose permease, a protein of E. coli, is composed of a single polypeptide that is 417 amino acids in length. By convention, the amino acids within a polypeptide are numbered from the aminoterminus to the carboxyl-terminus. Are the following questions about lactose permease true or false? A. Because the 64th amino acid is glycine and the 68th amino acid is aspartic acid, the codon for glycine, 64, is closer to the 3′ end of the mRNA than the codon for aspartic acid, 68. B. The mRNA that encodes lactose permease must be greater than 1241 nucleotides in length.
The concentration of RNase that Christian Anfinsen used in his denaturation/renaturation experiments was about 1 mg/ml. Inside the cell, the protein concentration is estimated to be more than 100 mg/ml. Predict the outcome of Anfinsen's experiments had he used a 100 mg/ml RNase concentration.
The genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a) Using the selections from the genetic code shown below, de-termine the amino acid sequence coded by the following seg-ment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG= methionine ;CCU= proline; CAU= histidine ;UGG= tryptophan AAG= lysine ; UAU= tyrosine ;GCC= alanine ;UUG= leucine ;CGG= arginine ;UGU= cysteine ;AAC =asparagine ;ACA=threonine ;UCC= serine ;GCA=alanine ;UCA=serine(b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?
Determine the isoelectric point of the peptide product of the mutated sequence: 5' - AUG UCC AUG AUU CUG GAA AUU ACC UCC AUC AUG AAG CGC UGA CCC AUU AUU AA - 3'
Consider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.