Q: Explain how do humans receive odors and scents,experience flavors, and experience pain and tickling ...
A: The feelings of smell and taste are related in fact, the two of them utilize similar sorts of recept...
Q: What salt did Meselson and Stahl use for their ultracentrifuge gradients? O NaCI O NH4CI O CSCI O Ca...
A: Given: DNA replicates semiconservatively. Matthew messelson and Franklin stahl performed an experime...
Q: J. ach compound on the left with its name on the right. Match the name with the functional E. group ...
A: Functional groups are atoms that bind to an organic molecule's carbon backbone and give certain prop...
Q: Which of the following events best explains the annual saw tooth pattern that is seen in the Keeling...
A: Introduction The Keeling Curve is a graph depicting the accumulation of carbon dioxide in the Earth'...
Q: CHARACTERISTICS EUKARYOTIC CELLS PROKARYOTIC CELLS Has a nuclear envelope DNA structure 2+ chromosom...
A: Prokaryotic DNA is double-stranded circular DNA that is dispersed in the nucleoid, a dense area of c...
Q: Describe five strategies that can be used to engineer resistance into crop plants. Which strategy do...
A: Introduction The main unit of study in agroecology is the agroecosystem, which is vaguely defined as...
Q: Which of the following is the correct pairing of phenotype and genotype of Individual 5 in the pedig...
A: ANSWER;- A)Dwarf, Homozygous dominant Explain;- A cross between two homozygous assortments generally...
Q: 1. IDENTIFY THE EPITHELIUM. 2. WHAT STRUCTURE IS LINED? 3. IDENTIFY THE ORGAN.
A: 1.
Q: DISEASE CAUSATIVE ORGANISM VECTOR
A: Causative organism or agent in infection are pathogens. vector is a quantity or phenomenon that has...
Q: Differentiate between: a. Biotic and abiotic component
A: An ecosystem is shaped by its biotic component. These are communities of organisms made up of variou...
Q: Insects are attracted to the flower of plants. When they rub against parts of the plant, they carry ...
A: The transfer of pollen grains(carrier of male gamete) from anther to stigma is known as pollination....
Q: kind to you. So I am having a problem answering this question and I need your help. Hoping for a res...
A: Answer
Q: Biology: Discuss the many properties of water H2O? And also give several examples of the important ...
A: Water is an essential component of life, life is impossible without water as we know that 1st time l...
Q: You want to mutate a Trp residue which is located in the interior of a protein structure. Which of t...
A: Amino acids are the monomers that are bonded by peptide bonds to make polypeptide chains.
Q: What is the function of DnaB, one of the three special proteins needed to form the initial replicati...
A: The replication process begins with the unwinding of the polynucleotide strand, which forms a replic...
Q: Enumerate two conditions that may lead to transformation of trophozoite to cyst stage.
A: The trophozoite is a motile vegetative stage that reproduces through binary fission and colonises th...
Q: Drag and drop the appropriate labels onto the cross section of the Cut Bank below the Highlevel/LRT ...
A: 6)River deposits. 5) vegetated berm 1)top soil(with brick)
Q: What becomes active during a sag in neuron which is an indication of hyperpolarisation activated cat...
A: Hyperpolarisation activated cation current (Ih) in neurons of the medial nucleus of the trapezoid bo...
Q: Why are fungal infections not easy to treat in humans and animals? answer the following in 3-6 sent...
A: INTRODUCTION In the environment, the fungi may cause various diseases in humans and animals. F...
Q: What is the consensus sequence of the bacterial promoter? (ΤΑΤΑAΤ 17±1 -- TTGACA O TTGACA 17±1 TATAA...
A: The promoter region of the organisms can be the Proximal promoter, core promoter, and distal promote...
Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)...
A: Central Dogma: It is the complete procedure of replication, transcription, and translation of DNA. T...
Q: Most dietary fiber is absorbed in the small intestine?
A: What are dietary fiber- Dietary fiber are the form of plant-derived food that cannot be completely b...
Q: Lipid-soluble molecules: O are considered polar molecules. O generally diffuse freely through the ce...
A: The correct answer is- generally diffuse freely through the cell membrane.
Q: Explain characteristics of peranosporales ,agaricales, polyporales and ustilaginales in detail.
A: Answer
Q: [ Select] are to water transport, as [ Select ] are to nutrient [ Select 1
A: Xylem is for water transport. Xylem is the tissue that is involved in transport of water and dissolv...
Q: Questions: 1- Name the different type of dialyzers. 2- What is relationship between hollow fiber por...
A: 1... Types of dialyzers cellulose triacetate (CTA), ethylene-vinyl alcohol co-polymer (EVOH), polyes...
Q: Methods of Bioremediation does not include Select one: a. Bioaugmentation b. Phytoremediation c. Bio...
A: Bioremediation: Bioremediation is a field of biotechnology that involves the removal of contaminants...
Q: The spindle apparatus is formed during the __________ phase of mitosis A. Anaphase B. Metaphase C. P...
A: Mitosis is a type of cell division in which the parent cell divides into two new daughter cells. Eac...
Q: In one statement maximum, explain what a hypertonic solution is in reference to solute concentration...
A: Based on the concentration of solute molecules present there are three types of solutions: 1. Hypoto...
Q: C. Solve these problems by listing the given genotypes, test crosses, genotypic and phenotypic ratio...
A: Serrated leaf is a dominant feature in plants that is represented by the genotype(Aa Aa) whereas smo...
Q: Identify the fibrous materials seen on the field.
A: Introduction Tissue which is composed of bundles of collagenous white fibres between which rows of ...
Q: what are the function(s) of the major organelles in the animal and plant eukaryotic cell?
A: Organelles are specialised structures found inside cells that perform a variety of tasks. "Little or...
Q: polymerase with 5'-3' as well as 3'-5' exonuclease and proofreading activity is Select one: a. Telom...
A: The error-correcting processes used in the genetics is known as the proof reading. During the proces...
Q: Please match the term with the description. the anterior end of a tapeworm that attaches to the insi...
A: Answers are in chronological order, 1 - Scolex 2 - Diploblastic 3 - Choanocytes 4 - Cnidocytes 5 - P...
Q: cite a situation where this environmental principles can be applied. All forms of life are importan...
A: Yes for biodiversity equivalence, due to dependancy from each other All forms of life are important.
Q: During ________, maternal and paternal chromosomes that occur in a gamete are shuffled. Group of ans...
A: Ans) This shuffling process is known as recombination or "crossing over" and occurs while the chromo...
Q: The prairie is approximately 100 acres of relatively flat terrain. Considering the “basic” sampling ...
A: A... Forest Administration is presently carrying out an eating the executives plan at Sheyenne Publi...
Q: 1999 Question #2 Communication occurs among the cells in a multicellular organism. Choose three of t...
A: Communication between two immune cell system is autocrine signalling where releaser itself is an acc...
Q: 1. IDENTIFY THE LINING. 2. IDENTIFY THE ORGAN. 3. IDENTIFY THE SPECIAL STRUCTURE. 1. 2. 3.
A: Introduction:- This organ starts from cricoid cartilage and finishes near the heart, where it splits...
Q: How can parents maintain a continuity of socioemotional development in their infants life
A: From the moment your child is born they are developing a sense of self and the world around them. Th...
Q: Why overwatering of plants results in yellowing of leaves
A: Introduction:- Plant growth is influenced by a variety of factors. Plants are sensitive to temperatu...
Q: can you explain me this slides how to identify and labeled them
A: ANSWER;- The picture is the slide to identify and label them;-
Q: ach radiographic study with the correct description. Uses a pencil-thin beam of radiation to create ...
A: Various instruments are used to image different organs inside the body. For example, X-rays, comput...
Q: Q) For a person at rest, aortic blood pressure is about 120 (torr 120) and blood velocity is (25 cm/...
A: Introduction: The blood flows under great pressure in the arteries and veins. Blood pressure may be ...
Q: In a cross between mice the genotypes AB/ab ab/ab, what is the recombination frequency if the prog...
A: Linkage is phenomenon which evaluates how two genes are located in a class se proximity to each othe...
Q: When looking at TV with your legs stretched out, your messenteric arteries _________ so that blood c...
A: 41)Stretching of the legs causes increased blood supply of the arteries and decreased stiffness of t...
Q: 3. In a plant population you identify and mark newly emerged seedlings in the spring. At the end of ...
A: The Hardy–Weinberg principle, also known as the Hardy–Weinberg equilibrium, model, theorem, or law i...
Q: Each time a new tRNA is added to the A site, it adds its amino acid to the bottom of the growing cha...
A: The description in the question is related to Protein synthesis or translation process which occurs...
Q: Arrange the following sentences to create an explanation about the role of hormones in human reprodu...
A: 1.* Hypothalamus are of two types which release two types off harmones. Releasing harmones Inhibiti...
Q: A cross between fruit files with genotypes Aa Bb × aa bb produces the following progeny: 10 Aa Bb 4...
A: Linkage is a phenomenon in which how genes are placed in close proximity to each other but in the sa...
Compare the binding of MHC molecules to antigen with the binding of BCR to antigen.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Describe the reason that it is useful that antibodies have two antigen binding arms.Explain one mechanism of antibody action against viruses.Draw a schematic diagram of a typical IgG molecule and label each of the following parts: H chains, L chains, intrachain disulfide bonds, hinge, Fab, Fc, and all the domains. Indicate which domains are involved in antigen binding.
- Describe the term "in-frame" and also the reason that it would be necessary for the generation of diversity in antigen receptors.Diagram the structure of an antibody. What parts bind toantigens? Why does each antibody bind only to one or afew specific antigens?Compare the MHC I and MHC II protein structures and peptidebinding sites. How do they differ? How are they similar?