hm-dCDP ACTP ATCGTACIGCA ATP NDP kinase H,0 PP; TAGCATGACGI (host cell enzyme) Cytosine-containing DI ADP dСТРase DNases hm-dCTP ACMP DNA polymerase hm-Cytosine 5,10-CH,-THF DCMP hydroxymethyltransferase ATHGTAHIGHAG THE TAGHATGAHGTH hm-Cytosine-containing DNA NH2 CH,OH UDP-glucose a- and B-glucosyltransferases UDP Glucosyl- hm-cytosine N. deoxyribose P. ATHGTAHIGHAG TAGHATGAHGTH hm-dCMP g ATP Deoxyribonucleoside monophosphate kinase Glucosylated DNA A FIGURE 19.22 Metabolic pathways leading to nucleotide modifica- tions in E. coli infected by phages T2, T4, or T6. Virus-coded enzymes are shown in red. hm, hydroxymethyl. ADP

hm-dCDP ACTP ATCGTACIGCA ATP NDP kinase H,0 PP; TAGCATGACGI (host cell enzyme) Cytosine-containing DI ADP dСТРase DNases hm-dCTP ACMP DNA polymerase hm-Cytosine 5,10-CH,-THF DCMP hydroxymethyltransferase ATHGTAHIGHAG THE TAGHATGAHGTH hm-Cytosine-containing DNA NH2 CH,OH UDP-glucose a- and B-glucosyltransferases UDP Glucosyl- hm-cytosine N. deoxyribose P. ATHGTAHIGHAG TAGHATGAHGTH hm-dCMP g ATP Deoxyribonucleoside monophosphate kinase Glucosylated DNA A FIGURE 19.22 Metabolic pathways leading to nucleotide modifica- tions in E. coli infected by phages T2, T4, or T6. Virus-coded enzymes are shown in red. hm, hydroxymethyl. ADP

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter4: Cell Structure

Section: Chapter Questions

Problem 43CTQ: Pathogenic E. coil have recently been shown to degrade tight junction proteins during infection. How...

See similar textbooks

Similar questions

Assume that you are a RNA polymerase. Which strand is the template strand? -5 ↓ 3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’
Transcribe the following DNA sequence into RNA, and then into amino acids 5’-GTATACTTGTGGGCCAGGGCATTAGCCACACCAGCCACCACTTTCGGATCGGCAGCC-3’ 3’-CATATGAACACCCGGTCCCGTAATCGGTGTGGTCGGTGGTGAAAGCCTAGCCGTCGG-5’
Name: Date: 2. The sequence of a fragment of one strand of DNA is AATTGCATATACGGGAAATACGACCGG. Transcribe this s sequence into MRNA. er bns eldst eboo oi ebitqeqylog erlt to noihiog eri qu elsm bluow tsri abios onime Jlaw as ye s 1ot noitem atelomet AHG 3. The following MRNA ştrand is being used to asemble a polyp
This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.
20:201 Foundations Cell Molec 48. The first 17 amino acyl residues in human preproinsulin are H₂N-MALWMRLLPLLALLALW-COOH and the encoding nucleotide triplets ("codons") in DNA are 5'-ATG GCC CTG TGG ATG CGC CTC CTG CCC CTG CTG GCG CTG CTG GCC CTC TGG-3'. Are these molecules written according to their colinearity? A) No. Colinearity is written C-N and 3'-5' for proteins and nucleic acids, respectively. Yes. Colinearity is written N→C and 5'-3' for proteins and nucleic acids, respectively. No. Colinearity is written C-N and 5'-3' for proteins and nucleic acids, respectively. D) There is no such a thing as colinearity. red by ribozymas
BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple
Arg-ser-ser-ala-pro Possibilities mRNA 3’ AGG UCA UCU GCU CCC 5’ 5’ ACC ACG CCU CCU GGC 3’ 3’ UCC ACG CCU ACU GGA 5’ 5’ CGC UCC CCU GCC CCC 3’ Possibilities coding strand 5’ TCC TCG ACT GCT GGA 3’ 3’ TCC TCG TGA CGA CGC 5’ 5’ CGG ACT ACT GCA CCA 3’ 3’ CCC ACG ACT CCT CGC 5’ Possibilities non- coding strand 3’ GGG TCA TCA CGG GGG 5’ 5’ TCC AGC AGC CGC GGC 3’ 3’ GCC TCA AGC CGA GGA 5’ 5’ TGG TGC TGA AGA TCA 3’
3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…
Met – Asn – Cys – Phe – Glu – Met – Leu – Arg – Ile – Asp – Glu – Gly – Leu – Arg – Leu – Lys – Ile – Tyr – Lys – Asp mRNA sequence (5’-3’)AUG – AAC – UGU – UUU – GAA – AUG – CUU – CGU – AUU – GAU – GAA – GGU – CUU – CGU – CUU – AAA – AUU – UAU – AAA – GAU - Write the dsDNA that encodes for this peptide
Mutation #2: • Change the Mutation to RED TACACC TIG GC GACGACT A U GU G G A A C C G C UG CUGA MET -TRP- ASN - ARG- CYS - (STOP) Original DNA Sequence: MRNA Sequence: Amino Acid Sequence: Mutated TAC GÁC CTT GGC GAC GÁC T DNA mRNA Amino Acid Will this mutation have an effect? What kind of mutation is this? Mutation #3: • Change the Mutation to RED TACACCTT G G C G A C GACT AUGUG G A A C C G C U G C U G A MET -TRP- ASN - ARG- CYS - (STOP) Original DNA Sequence: mRNA Sequence: Amino Acid Sequence: Mutated TAC ACC TTA GCG ACG ACT DNA MRNA Amino Acid Will this mutation have an effect? What kind of mutation is
answer all subpart to upvote because vert short question otherwise dislike Viruses that infect bacteria (bacteriophage) sometimes encode a lysozyme gene in their genome. The gene gets inserted into the bacterial genome and gets expressed in the same way that bacterial genes get expressed. A) What location in the bacterial cell would the gene get transcribed into mRNA? (1 sentence max) B) What protein complex would perform the transcription to produce the mRNA? (1 sentence max) C) Where in the bacterial cell would the gene get translated? (1 sentence max) D) What protein complex would perform the translation to produce the protein? (1 sentence max)
GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.