Hypertrophic cardiomyopathy is caused by mutations in the β-myosin heavy chain gene. One common mutation involves a change of an arginine (Arg) to a glutamine (Gln) at position 403. Using the genetic code shown above, what could the sequence of the mutant codon be? a. CAA b. CGA c. CGG d. CAC
Q: Which of the following is incorrect? a. A heterodimer is composed by two identical polypeptide…
A: a) The heterodimer is composed of two different subunits, they are not made up of two identical…
Q: A glucose 6-phosphate dehydrogenase (G6PD) knockout mouse was created but none of the pups survived.…
A: Glucose-6-phoshate dehydrogenase deficiency is a genetic disorder in which hemolysis of red blood…
Q: Amylase is an enzyme that catalyzes the release of smaller sugar molecules from starch.…
A: α-amylase and α-glucosidase digest the carbohydrates to simple form i.e glucose, thereby increases…
Q: This is a plot under standard conditions of free energy corresponding to a chemical reaction of A+B…
A: The free energy of a reaction is the amount of energy that is actually available to do work. It also…
Q: If I take a sample of a person's white blood cells, 60% to 70% of them will be the "first responder"…
A: White blood cells are also known as leukocytes which are involved in the immune responses. They're…
Q: Answer the given questions. Draw clearly what is given and FOLLOW INSTRUCTIONS.
A: Thermophilic bacteria live at higher temperatures such as hot springs and hot thermal vents. The…
Q: Describe the levels of structure of a protein and tell how they would be affected by: a. Hydrolysis…
A: Proteins are composed of amino acids. They are linked together by peptide linkages. Proteins have…
Q: What makes the lesson about carbohydrates important to our daily life?
A: Biological processes require several different macromolecules for their metabolic and functional…
Q: Received information is called a transduced signal because: this process often has many steps of…
A: Cell signalling involves the transmission of an external signal to the cell's interior for proper…
Q: QUESTION 14 Match pairs of terms together that have the same value b. 1 micromole 1 μmole/l 1 mM 1…
A: 0.1 = 10-1 (deci)0.01 = 10-2 (centi) 0.001 = 10-3 (milli) 0.000 001 = 10-6 (micro)0.000 000 001 =…
Q: omplex II of electron transport chain is involved in the KREB'S Cycle during the conversion of…
A: Tricarboxylic acid (TCA) cycle or the citric acid cycle is the principle source of energy for cells…
Q: Which of the following is incorrect about the conversion of pyruvate and NADH to lactate and NAD+? O…
A: If a cell lacks mitochondria or sudden need of energy arises due to rapid consumption of oxygen by…
Q: discuss the method used to undertake rsk assessment in laboratories handling pathogenic…
A: Risk assessment term is defines the possibility of quantitatively measuring the harm caused by a…
Q: Consider the following reaction. CH₂-CH-COO-CH₂-C-Coo- он b Which group of enzymes catalyzes this…
A: The six functional classes of enzymes are hydrolases, oxidoreductases, lyases, transferases, ligases…
Q: Glucose molecules produced during photosynthesis contain higher levels of carbon-12 than carbon -13…
A: In nature, two stable isotopes of carbon exist, carbon 12 and carbon 13. Carbon 13 has one extra…
Q: (a) The TCA cycle plays a central role in the aerobic catabolism of fuel molecules. Explain the…
A: TCA or tricarboxylic acid cycle occurs under aerobic conditions where pyruvate is oxidatively…
Q: Consider the following properties of the protein components of a sample mixture as provided in the…
A: Proteins are composed of twenty standard amino acids attached together via peptide bonds. These…
Q: In the G protein signaling pathway, the 2nd messenger is: a. ATP b. GDP Oc. Cyclic GMP d. Cyclic AMP…
A: The G-protein signalling pathway play important role in metabolic regulations, embryonic…
Q: Н Н К НО Н CH₂OH ОН Н ОН Glucose Н ОН + ATP hexokinase Н НО CH₂OPO- Н ОН Т- Н ОН Н ОН…
A: The conversion of glucose to glucose-6-phosphate is coupled with the hydrolysis of ATP to ADP and…
Q: Calculate the pl of the amino acid using the titration curve. 04 pH 0 6 8 SO 10 O 12.0 12 10.0 8.0…
A: Pi is the isoelectric point. This is the pH at which the Amino acid carries no net charge. The…
Q: Consider the peptide with the sequence SANTACLAUSISASTALKER. Assume this entire pepide were a single…
A: Proteins are the heteropolymers of amino acids. The proteins are made up of twenty standard amino…
Q: Which of the following amino acid residues cannot act as a nucleophile? a. Serine b. Glutamate C.…
A: Amino acids are the building blocks of proteins. They have side chain R groups that are important…
Q: How many amino acids are in the following peptide? H₂N H3C ZI CH3 IZ O=C CH3 `N H HH OH | LOH
A: A polypeptide chain constitutes of amino acids are linked together via peptide bonds. The proteins…
Q: In the peptide Ser-Cys-Ala-Gly, the N-terminal end is glycine. O cystein. O serine. Oalanine.
A: A peptide is a chain of amino acids, in which the individual amino acids are linked together through…
Q: The enzyme Lysozyme is present in human nasal mucus and catalyzes the breakdown of a component of…
A: Enzyme kinetics determines the kinetic parameters of enzyme such as the maximum rate of the reaction…
Q: 6. Explain what effect the soap had on the mixture. Did the oil and water mix better? Refer to the…
A: Molecules which do not interact with water are called non-polar or hydrophobic and water loving…
Q: In oxidative phosphorylation, how many molecules of ATP are produced per molecule of NADH in the…
A: The electron transport chain and chemiosmosis are two parts of oxidative phosphorylation that are…
Q: What class of enzyme most likely catalyzes the reaction shown in the figure? (choose the one best…
A: Given that Fumarase enzyme catalyses the reversible hydration of fumarate to S-malate. Fumarase…
Q: Differentiate the levels of protein structure from primary to quaternary.
A: Proteins are biomolecules composed of amino acids. The amino acids are joined together through…
Q: What is the event that ends the first stage of glycolysis? synthesis of NADH synthesis of…
A: Glycolysis is the first step of oxidation in glucose metabolism in which glucose is converted to…
Q: Use a calculation based on the pH partition model to determine the likelihood that a weakly acidic…
A: According to the pH partition model, for a weakly acidic drug the Henderson-Hasselback equation is…
Q: Which of the following is incorrect? a. The ratio "catalyzed rate/uncatalyzed rate" is known as…
A: The Enzymes as biological catalysts. In the enzyme catalyzed reaction, the substrate is converted to…
Q: 1.Growth factor binding and dimerization Tyrosine kinase domain Growth factor 2. Autophosphorylation…
A: In contrast to G protein-coupled receptors where the cytosolic domain of the receptor is close to…
Q: Table 1, Effect of enzyme concentration Amount of lodine Test Results (color) Amylase Enzyme 0 drops…
A: There are various tests used to detect the presence of polysaccharides including disaccharides and…
Q: Which of the following amino acids have basic (i.e., positively charged) side chains? Serine…
A: The pKa of the ionizable groups on an amino acid determines its net charge at a particular pH. Based…
Q: how lactic acid reach the damage muscle.
A: In humans due to intense exercise, the muscle cells lack oxygen for aerobic respiration and hence it…
Q: A 2.0kb bacterial plasmid ‘BS1030’ is digested with the restriction endonuclease Sau3A; the plasmid…
A: Plasmids are small, circular, double stranded, and extrachromosomal bacterial DNA. i.e. it is…
Q: 1. What are the products of beta oxidation of a 21-carbon fatty acid? (Provide the number of each…
A: Fatty acids are the important components of lipids. Simple lipids are composed of fatty acids that…
Q: What if all the data above was the same EXCEPT with the change of G & X? Their new data is below.…
A: The DNA double helix is made of two linked strands that are wound in a helical shape. The two…
Q: onversion of NAD+ to NADH is accomplished by the addition of
A: Conversion of NAD+ to NADH is accomplished by the addition of an electron.
Q: How many net molecules of nucleoside triphosphate (ATP and equivalent molecules) are produced by…
A: As you have posted multiple unrelated questions we are supposed to answer only the first question…
Q: 5′ - A U G C A A U A C A A U C C G G A A U G A - 3′ Give the primary structure of the protein that…
A: The translation is the process of synthesis of amino acids from the mRNA. During the translation…
Q: The image below shows the urea cycle. Based on the information in the image, which of the following…
A: Urea cycle is an important pathway to eliminate ammonia by converting it into urea which can easily…
Q: Consider the given image. What type of interaction is depicted by the dotted line in the given…
A: The non covalent interactions that are responsible for folding of proteins are hydrogen bonding,…
Q: The enzyme Lysozyme is present in human nasal mucus and catalyzes the breakdown of a component of…
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…
Q: A: State the Lineweaver Burke equation. B: Calculate the kinetic parameters Vmax and KM from the…
A: Parameters such as Km and Vmax are used for comparing enzyme activities. If we know the initial rate…
Q: What makes an enzyme stereospecific? Give one example of an enzyme that stereospecific and discuss
A: An enzyme is a protein (or RNA) that can act as a biological catalyst and speed up the rate of…
Q: hoose the conditions when PDH is activated. a) acetyl CoA/CoA ratio is high b) NAD+/NADH ratio is…
A: PDH is a regulatory enzyme situated in inner mitrochondrial membrane which is comprise of three…
Q: Many antibiotics alter the rate of reaction for enzymes that produce and then cross-link the strands…
A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: Describe the composition of bacterial cell walls.
A: The cell wall in bacteria tends to form a stable frame of constant thickness all around cell and is…
Hypertrophic cardiomyopathy is caused by mutations in the β-myosin heavy chain gene. One common mutation involves a change of an arginine (Arg) to a glutamine (Gln) at position 403.
Using the genetic code shown above, what could the sequence of the mutant codon be?
a. |
CAA |
|
b. |
CGA |
|
c. |
CGG |
|
d. |
CAC |
Step by step
Solved in 3 steps
- 3 attempts left Check my work Be sure to answer all parts. Re Consider the following sequence of DNA: 3'-AGA CCC-5'. a. What dipeptide is formed from this DNA after transcription and translation? b. If a mutation converts CCC to CCA in DNA, what dipeptide is formed? Gu c. If a mutation converts CCC to CGC in DNA, what dipeptide is formed? d. If a mutation converts CCC to GCC in DNA, what dipeptide is formed? a. b. c. d.C UUU UUC Phe UUA UCU) UCC UCA UAU UAC Tyr UGU UGC Cys Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUG FLeu UCG CUU CUC CCU] СС CAU1 CAC САC His САА Gln CGU CGC Arg Leu Pro CUA CUG ССА CGA CUG J CCGJ Which of the following tRNA anticodons could theoretically base pair effectively with the codons 5'-AAU-3' and 5'-AAC-3' through third-base CAG, CGG AGU AAUASN AGC AUU AUC File A AUA ACU АСС АСА AAC FAsn AAA Ser C Thr AGA Arg A AUG Met ACG AAG Lys AGG GCU] GCC GCA GCG GGU GGC Gly GGA GAU1 GUU GUC GUA GUG Asp GACJ GAA C Val Ala A GAG Glu GGG wobble? 5'-GGG-3' OI. 5'-AUG-3' II. 5'-GUU-3' I. 5'-CAT-3' IV. 5'-AAA-3 V. Third letter UCAG UUAG A, First letterSecond letter C UUU UGU UGC. UUC Phe UUA UUG UCU UCC UCA UCGJ UAU1 UAC. Ser UAA Stop UGA Stop A Tyr Leu UAG Stop UGG Trp CAUTHIS CACS CAA GIn CAG CGU CGC Arg CCU CUU CỤC CỦA CUG J CC Leu Pro ССА CGA CCGJ CGGJ AGU Ser ACU АСС ACA AUU AAU Asn AAC AAA AUC le AGA TArg Thr AUA AUG Met ACG AAGLYS AGG GAU GUU) GUC GUA GUG GCU) GCC GCA GACASP GAA AGlu GAGS GGU GGC Gly Val Ala GGA GGG GCGJ Given the following mRNA sequence: 5' GCCCAUGUGGCGCGAGUGAUUUAA 3' Third letter UCAC UCAG UCAG UCAG 등 | First letter
- b ueton S deo4 winged dincs anel Samuels-V x r Sing https://docs.google.com/document/d/1Rd3yEXBWtvpR3nXlyNdEYqyjdDgOts37t7tMXZFQXU/edit B Untitied dxument - G X ert Format Tools Add-ons Help Last edit was seconds ago Normal text Arial 18 IUA 加 证,而,回 X ent will 1. Larry Martin and David Burnham (U of Kansas) made their 3-D model of microraptor from a mold of a single microraptor fossil. How was the hip joint of the model configured and what does this suggest about microraptor and the origin of flight? 947 AM #メ 144 240 MO 8. 6.PAYS- DASO บบบ 1 UUC UUA UUG CUU CUC CUA CUG U '} GUU GUC GUA GUG PHE LEU AUU AUC AUA AUG MET or START LEU ILE VAL UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Second base SER PRO THR ALA UAC} TYR UAA UAG } STOP CAU CAC CAA CAG} AAU AAC AAA AAG J HIS GLN ASN LYS GAU ASP GAC GAG GLU UGU CYS UGC UGA} STOP UGG TRP CGU CGC CGA CGG AGU AGC AGA AGG G GGU GGC GGA GGG ARG SER ARG GLY SCAR SCAG Аpunnet squares
- Consider the mRNA sequence below. Assume that the following mRNA segment has been translated. 5'-UACCGAAUGUCU-3' Note for numbers 1 and 2: Use the three-letter abbreviation of amino acid; separate amino acids with a hyphen: do not include the stop codon. Example: ala-cys-glu 1. Using the table of the genetic code, determine the sequence of amino acids. 2. If mutation occurs by substitution of the 12th nucleotide with cytidine-5'- monophosphate, what is the resulting amino acid sequence? 3. What type of mutation occurred? Choose from same sense, missense and non-sense.I'm not sure why this structure is incorrect, can you help me draw it correctly please?Asap plz all parts
- First base U A G U UUU UUC UUA UUG CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met or start Val Second base C A UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala UAU UGU Tyr Cys UAC UGC UAA Stop UGA Stop A UAG Stop UGG Trp CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG His Gin Asn Lys Asp G Glu CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG Arg Ser Arg Gly UCAG UCAG ט כ с AG А U ט כ C G Third base A mutation in the DNA that codes for hemoglobin changes the sequence CTC to CAC. This will cause a change in the mRNA from (original) ? to (mutated) __?____, resulting in the addition of the amino acid, (mutated) ____?___, instead of (original) ____?_hidden message of the cide: 5' - UGAUGAUGAUGAUGCAUGCUAACGAUUCCGCAAUGUCGAUAUCAAUACGUUGACC-3'C A UUU U UUC Phe UCU UCC UCA UAU UAC UAA UAG UGU Cys U UGC Stop UGA Stop Stop UGG Trp G Tyr Ser UUA UUG Leu UCG CUU C CUC CUA CCU Leu ccc CCA CCG CAU CAC CAA His CGU CGC CGA CGG Pro Arg 1st Gin CUG CAG 3rd letter AUU A AUC AUA AUG ACU AAU AAC Ser u letter C Asn AGU AGC AGA AGG lle ACC Thr ACA AAA AAG Lys Arg Met ACG GUU G GUC GUA GUG GCU GCC GCA GCG GAU GAC GAA GAG Asp GGU GGC GGA GGG Val Ala Gly Glu Not all of the following ingredients are necessary for an in vitro translation reaction. Which one would you leave out? A ssDNA template O Cell sap containing ribosomes poly(U) O 14C-Phe