Identify the mRNA codons that could have been used in the protein synthesis process to convert DNA to Gly-Ser-Leu-Tyr-Asn-Ser-His-Glu-Pro-Pro-Ala-Arg-Asp. Don't forget to start and stop codons.
Q: v Vitamin E A. diminished intestinal absorption of lipids v Vitamin K B. night blindness v Vitamin A…
A: Vitamin are organic chemical compounds that are not synthesised by our body. They are required in…
Q: Which of the following is a product of the first stage of the pentose phosphate pathway? Group of…
A: NADPH : Phosphorylated version of the coenzyme NADH Pentose Phosphate Pathway : PPP 1st stage of PPP…
Q: Which metabolic pathway converts glucose into two molecules of pyruvate and ATP? Group of answer…
A:
Q: Given ohationg im which is a Jlist of orgamelles ņ mitochondira, endopla smic rediculerm,pesoxisomes…
A: A cell is composed of a cell membrane, cytoplasm, and cellular organelles in the cytoplasm.…
Q: In which of the following citric acid cycle reactions does the coenzyme FAD participate?* citrate -…
A: The citric acid cycle (CAC), also called as the TCA cycle (tricarboxylic acid cycle) or the Krebs…
Q: A recent genome sequencing project for the bacterium Burkholderia mallei has identified a new…
A: The new protein identified here has a partial sequence given as TVEVNAPGDVQKALSELQQINDGRLDIRI…
Q: In which of the following processes is glucose 6-phosphate the end product? Group of answer…
A: Glucose : Carbohydrate that serves as the major energy source for the body. Glucose-6-phosphate:…
Q: Some of the mammalian Hox genes have been shown tobe more similar to one of the insect Hox genes…
A: The Hox genes are a group of transcription factor genes that have a unique property: they all have…
Q: The pH vs charge graph for a triprotic amino acid is shown below. Please answer the following…
A: An amino acid with the ability to donate 3 protons (3 H+) is called a triprotic amino acid. The 3…
Q: a. How much ATP is generated in the complete oxidation of glucose in skeletal muscle, taking into…
A: Complete Oxidation of Glucose takes place in multiple steps in different compartment of cells.…
Q: 9. It is noted recurrent vomiting, weakness, sleepiness, and convulsive attacks, as well, in…
A: The ureotelic organisms are the organisms, which convert the ammonia formed through protein…
Q: What is enzyme specificity?
A: The metabolic processes involve several metabolic pathways each with several chemical reactions…
Q: With Fehling's reagent (under certain conditions) interact: A. Glucose B. Quinine hydrochloride C.…
A: Fehling's reagent is a reagent commonly employed in differentiation of water soluble carbohydrates…
Q: a deaminating agent 5-BU is that can base-pair ike cytosine or like if 5-BU is cytosine incorporated…
A: 5-Bromo Uracil and nitrous acid are mutagenic agents. It means both of these agents cause mutation…
Q: I want a solution that is 1/10th the strength of my stock solution. I want 20 microliters of total…
A: A solution can be diluted to the desired concentration by using the formula C1V1=C2V2 Where C1=…
Q: 1. DNA replication is described as semi-conservative because A. one leading strand and one lagging…
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first 3…
Q: 1. Of which of these do your cells have the least of? A. MRNA B. FRNA C. TRNA D. NDNA E. Proteins 2.…
A: Cells are composed of different components, cell organelles and molecules that are responsible for…
Q: Question 17 In a glucometer, glucose oxidase catalyzes the redox reaction of glucose to form…
A: Glucometer is the instrument used to measure and display the amount of glucose level in the blood.…
Q: Arrange the following FAs in decreasing melting point. * A. A 22-carbon series saturated FA B. An…
A: Melting point of Fatty acids depend upon several factors like Molecular weight Degree of Saturation…
Q: 1. Draw the complementary DNA strand for the given: 5'-A-T-C-C-G-A-A-T-T-G-3' Answer: 2. Draw the…
A: In a complementary base pairing, purine pairs with a pyrimidine. A always pairs with T, similarly C…
Q: Fill in the blanks in the table below regarding the similarities and differences between two…
A: The replication of DNA involves opening up a double-stranded DNA molecule and creating a…
Q: Given Ribose, Briefly explain its expected reaction (based on their structural formula) to the…
A: Ribose is a pentose sugar. It is an alose. The structure of ribose is given below: Qualitative…
Q: In Metabolic Pathways, what are the nucleotide-containing compounds?
A: A nucleotide mainly consists of a sugar molecule that is either ribose in RNA or deoxyribose in DNA…
Q: Explain how energy is invested, stored, and released via chemical reactions
A: Energy is the organism's fundamental requirement. All of an organism's actions require this energy.…
Q: The process of protein decomposition by pepsin enzymes in stomach is assumed and modeled as a batch…
A: The reaction kinetics given in the pepsin digestion reaction follows Michaelis-Menten Kinetics. The…
Q: well-conserved regions in multiple sequence aligmements: a. are areas of structural importance b.…
A: Multiple Sequence Alignment (MSA) is the alignment of three or more comparable length biological…
Q: What might be the dangers in using supplements to get DHA in your diet?
A: Docosahexaenoic acid (DHA) is an omega-3 fatty acid found in cold-water fish like tuna and salmon,…
Q: 9. Which of the following statements about trypsin, chymotrypsin, and elastase are true? A. They are…
A: Trypsin, Chymotrypsin and Elastase all three are protein digesting enzyme which uses its active site…
Q: reaction
A: Hess law is mainly used to find out specific unknown enthalpy change. It is particularly useful for…
Q: Question 3 -- / 1 What form(s) of chemical energy are generated during cyclic photo-phosphorylation?…
A: Introduction: Photophosphorylation is the process by which photosynthetic organisms use the energy…
Q: When do plants usually undergo mitochondrial respiration?
A: Mitochondrial respiration is commonly known as cellular respiration. This is the process of energy…
Q: If the extracellular K* concentration increases to 20 mM, what would be the Nernst Potential of K*…
A: Membrane potential is the voltage difference between inside to outside of the cell. In absence of…
Q: Principle involved in the isolation of gluten * (Please choose one correct answer only) A.…
A: The protein component of wheat flour is called Gluten. This basic component gives elasticity and…
Q: Unsaturated fatty acids are commonly esterified at the hydroxyl substituent of glycerol at what…
A: Glycerol : It has 3 hydroxyl groups that get esterified with 1,2 or 3 fatty acids giving…
Q: For you, what is the contribution around 18-1900 of golden era in biochemistry? Explain
A: Introduction: The term biochemistry refers to the study of the chemistry of living things including…
Q: What is the significance of the positioning of the amino acid side chains and alpha carbons as you…
A: Proteins are polymers of amino acids linked by peptide bond/amide bond. Peptide bond is a covalent,…
Q: Fermentation occurs when is in too scarce amount to continue Its purpose is to re-generate so that…
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: 6. When a concentrated alkali solution acts on the purine cycle, it breaks down: A. Ester group B.…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: All these enzymes hydrolyze disaccharides in the small intestines EXCEPT maltase sucrase…
A: Disaccharides are substances that are made up of two molecules of simple sugars linked together.…
Q: The portion (the C-terminal end) of original substrate with the new amino terminus diffuses away.…
A: Introduction: Enzymes have a spectacular ability to accelerate the rate of a chemical reaction.…
Q: 3. A 2-year-old child was taken to the hospital. His mother said that he vomited frequently,…
A: The inborn error in metabolism occur due to mutation in a gene of the metabolic pathway.
Q: The purpose of the carbohydrate in the food industry and its frequency of use
A: A carbohydrate is a biomolecule made up of carbon (C), hydrogen (H), and oxygen (O) atoms, with a…
Q: 1. Foods cannot be compared without determining the “per gram" values. Explain the reasoning behind…
A: Nutrients are substances required by the body, for the growth and development, reproduction, and to…
Q: 1 Suppose that you have 1ml of a buffer solution with a pH of 6.8 and you add 1ml of 2% starch…
A: Salivary amylase is an enzyme that works on catalytic digestion of starch. Salivary amylase…
Q: You want 235mL of a solution that consists of 10% BSA, 2.37mM KCl and 120µM EDTA. You have stock…
A: BSA is a globular proteins which is a well studied proteins and used as standard protein molecule in…
Q: Question 17 Which of the following is a fatty acid with this notation, 16:0 O Myristic acid Stearic…
A: In a fatty acid the notation x:y is represented by an integer where x is the number of carbon in the…
Q: A polypeptide is shown below. Please answer the following questions. OH В A C H;N E H D H a. Match…
A: A polypeptide is a long, unbranched chain of amino acids joined by peptide bonds. To generate an…
Q: malate + NAD+ oxaloacetate + NADH + H+ If the pH = 7 and [malate] = 0.0010 M, [oxaloacetate] =…
A: Malate + NAD+ →Malate dehydrogenase Oxaloacetate + NADH + H+ Above reaction is the last step of…
Q: Explain to me what factors influence permeability versus solubility?
A: To understand the factors effecting the solubility and permeability it is essential to understand…
Q: Compare and contrast the de novo synthesis of purine and pyrimidine ribonucleotides. Move each…
A: There are two biosynthetic pathways for the synthesis of nucleotides: De novo pathway: The bases are…
Identify the mRNA codons that could have been used in the protein synthesis process to convert DNA to Gly-Ser-Leu-Tyr-Asn-Ser-His-Glu-Pro-Pro-Ala-Arg-Asp. Don't forget to start and stop codons.
Want solution ASAP
Step by step
Solved in 2 steps
- If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Use the codon chart below to help you: second letter A G UAU Tyr UGU UUU UCU Phe Сys UUC UCC UAC UGC Ser UAA stop |UGA stop | A UAG stop UGG Trp UUA UCA UUG Leu G UCG CUU CCU CAU CGU His CUC ССС САС CGC Leu Pro Arg CUA ССА САА CGA Gln CUG CCG CAG CGG AUU ACU AAU AGU Asn Ser AUC le A AUA AAC AAA AGC AGA Arg АСС Thr ACA AUG Met | ACG AAG Lys AGG GUU GCU GAU GGU Asp GUC Val GUA GAC S GAA Glu GCC GGC Gly GGA Ala GCA GUG J GCG GAG GGG) O 3' AGACGTTTCAAT 5' O 3' UGUGCAAAGUUA 5' О 5 TGTGCTTТCТТА 3' first letter UCAG UCAG PCAG third letterGiven the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…The name for the kind of point mutation/base substitution when a codon changes from CCC (which codes for proline) to CGC (which codes for arginine) is mutation. 2nd base in codon U CAG Cys Cys STOP STOP Trp Arg Arg Arg Arg Ser Ser Arg Arg Gly Gly Gly Gly Phe U Phe Leu Leu Ser Ser Ser Ser Tyr Tyr STOP Leu Leu Leu Leu Pro Pro Pro Pro His His Gln Gln C Asn Asn lle lle lle Met Thr Thr Thr Thr Ala Ala Ala Ala Lys Lys Asp Asp Glu Glu Val Val Val Val 3rd base in codon DCAGUCAGUCAGUCAG 1st base in codon
- Use the genetic code table. Which amino acid is coded for by only one codon sequence? Second Position U A G UUU Phe /F UCU UAU UGU UUC Tyr/Y Cys/C UCC UAC UGC Ser /s UUA Leu /L UCA UAA STOP UGA STOP UUG UCG UAG STOP UGG CUU CCU CAU CGU CỤC His / H Leu /L CC САС Pro / P CGC CUA ССА Arg/R CAA CGA CUG Gln /Q CCG CAG CGG AUU ACU AAU AGU AUC le /i ACC Asn / N Ser /S Thr/T AAC AGC AUA ACA AAA AGA AUG Met / M ACG Lys/K Arg/R AAG AGG GUU GCU GAU GGU GUC Asp/ D G Val /v GCC Ala / A GAC GGC GUA GCA Gly/G GAA GGA GUG GCG Glu /E GAG GGG valine serine threonine isoleucine methionine MacBook PrO G Search or type URL +, #3 Third Position SCAG UCAGU CAGU CA First PositionA segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)Using the Genetic Code Table in Figure 1.3, what is the proper sequence of amino acids in the polypeptide chain based from the given codons of MRNA (3' AAU GCC AGU GGU 5')? * U UUU Phe UCU) UC UCA UCG UAU] UAC Tyr UAA Stop UGA Stop A UAG Stop UGG Trp G UGU U UUC) UGC Cys Ser UUA Leu UUGJ CU) CCU CAU1 CGU His CUC CAC CAA CGC CC Leu CCA Pro Arg CUA CGA A Gin CUG) CG CAG CGG G AUU) ACU) AGU AAU1 Asn AAC, Thr AAA1 U AGC }Ser č A G AUC lle ACC A AUA J ACA AGA AUG Met ACG, AAG}Lys AGG Arg GGU GUU) GUC Val GCU) GCC GCA GCG J GAU1 Asp GACI Ala GGC GGA GGG ) G GUA Gly GAA1 GAG) A Glu GUG) G Figure 1.3 Alanine, Serine, Glycine, Asparagine Serine, Glycine, Asparagine, Alanine Glycine, Asparagine, Alanine, Serine Asparagine, Alanine, Serine, Glycine
- Use the codon chart to determine the following RNA strand in amino acids (Remember to write it the same way the strand is): ACA-AGG-UUA-UGA second letter C A UAU Tyr U UUU UCU UGU Phe Cys UUC UCC UAC UGC C Ser UAA stop | UGA stop| A UAG stop UGG Trp UUA UCA UUG Le UCG CUU CCU CAU CGU His CUC ССС CAC CGC Leu Pro Arg CUA ССА САА CGA Gln СCG CAG CGG CUG AGU AAU Asn AUU ACU Ser AGC S AGA Arg AAC AUC } lle A AUA АСC Thr AAA Lys АСА AUG Met ACG AAG AGG GUU GCU GAU GGU Asp GAC GGC Gly GGA GCC GUC Val Ala GAA GAG } GUA GCA Glu GGG GUG GCG Your answer first letter ACUCAGUCAGUCAG third letterUsing the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.If DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- G
- Using the genetic code table provided below, write out the sequence of three different possible mRNA sequences that could encode the following sequence of amino acids: Met-Phe-Cys-Trp-Glu C A G U C UUU Phe UCU Ser UUC Phe UCC Ser UCA Ser UUA Leu UUG Leu UCG Ser CUU Leu CCU Pro CUC Leu CUA Leu CUG Leu CCG A CAU His CGU Arg CCC Pro CAC His CGC Arg UAU Tyr UGU Cys U UAC Tyr UGC Cys C Stop UGA Stop Stop UGG Trp UAA A UAG G CCA Pro CAA Gln Pro CAG AUU lle AUC lle AUA lle AUG Met ACG G 등등 Gln CGA Arg CGG Arg ACU Thr AAU Asn AGU Ser ACC AAC Asn AGC Ser Thr ACA Thr Thr AAA Lys AGA Arg AAG Lys AGG Arg GUU Val GCU Ala GAU Asp GGU Gly GGC Gly GUC Val GCC Ala GAC Asp GUA Val GCA Ala GAA Glu GGA Gly GUG Val GCG Ala GAG Glu GGG Gly U C A G U C A G SUAUSecond letter C A UUU Phenyl- UUC alanine UCU UCC UAU UAC UGU UGC Tyrosine Cysteine Serine UCA UCG UAA Stop codon UAG Stop codon UGA Stop codon UGG Tryptophan UUA A Leucine UUG CCU ССС CAU CAC CUU CGU CGC Histidine C CUC C CUA Leucine Proline Arginine CCA СCG CGA CGG A CAA CAG CUG Glutamine AGU AGC AUU AAU ААС ACU Asparagine Serine AUC Isoleucine A AUA ACC АСА Threonine AAA AGA Methionine; start codon ACG Lysine Arginine AUG AAG AGG U GUU GUC GUA GCU GCC GCA GAU Aspartic GAC acid GGU GGC GGA GGG Valine Alanine Glycine GAA Glutamic GAG acid GUG GCG G Given the codon UCA in the first exon of a gene, which change is most likely to result in a nonsense mutation? A transversion of A to U Change of nucleotide in the third position Change of nucleotide in the first position A transition of A to G Change of nucleotide in the second position First letter Third letterhe sequence is read from left to right. The table below shows which mRNA codons code for each type of amino acid. UUA - Leu | UCA - Ser UAA - Stop | UGA-Stop UUU - Phe | UCU - Ser UAU- Tyr UGU- Cys CỦA - Leu CCA - Pro CAA - Gln | CGA - ArgA UUG - Leu UCG - Ser| UAG-Stop UGG- TrpG A DNA sequence before and after replication IS SHO Second mRNA base G DNA sequence before replication: UUC - Phe UCC -Ser UAC U TACCTAGCT Туг UGC Cys DNA sequence after replication: A TACCTCGCT Leu CCU - Pro CAU - His CGU. CUU Arg U - Pro CAC - His CGC- ArgC CUC - Leu ССС Pro CAG - Gln | CGG - Arg G CUG - Leu CCG Thr AAU - Asn AGU - Ser Ile ACC - Thr AAC- Asn AGC Ile ACU AUU AUC Ser Lys AGA Arg Thr AAG - Lys AGG - AUA Ile ACA - Thr AAA- A mutation occurred in the DNA sequence during replication. Which of the following, A-D, Arg Asp GGU-Gly AUG - Met ACG GUU - Val GCU - Ala GAU - GỤC - Val GCC - Ala GAC - Asp GGC - Gly Val GCA -Ala GAA - Glu GGA - Gly Val GCG - Ala GAG-Glu GGG-Glv describes the result of the…