Q: Why are cell membranes disrupted by soap?
A: Please note that of the two unrelated questions posted together, the first one has been answered…
Q: identify the 3' and 5' ends of the DNA segment AGTCAT
A: Deoxyribonucleic acid (DNA) is the genetic element composed of two polynucleotide chains which coil…
Q: The following is the sequence on one of a DNA molecule A A T G C C A G T G G T 1. If this strand is…
A: “Since you have posted a question with multiple sub-parts, we will solve first three sub parts for…
Q: In the "Indexing DNA" method of n k-mer table, the maximum number of compares when the k-mers are…
A: Indexing of genome is done in order to index all the small sequenes within the large genome.The…
Q: Aside from Sanger Sequencing, what are the other DNA sequencing methods that are available today?…
A: Sanger sequencing is a DNA sequencing technology that uses electrophoresis and is based on DNA…
Q: Why does Valerie's blood from her peripheral, tumor and breast samples all show bands of DNA that…
A: Many risk factors for cancer have been identified, including exposure to certain carcinogens in our…
Q: On paper, replicate the following segment of DNA: (UPLOAD PHOTO OF YOUR ANSWER) 5' ATCGG CTACGITCAC…
A: Replication is the process of making two similar DNA units from a double-stranded DNA molecule.…
Q: 6. Identify the DNA sequence below. Write the DNA sequence in 5' to 3' orientation.
A: The DNA (deoxyribonucleic acid) sequence is the order in which the nucleotide bases are arranged.…
Q: Uptake of naked DNA from the environment is known as:
A: Since there are multiple questions in this particular question, I will answer the first one for you.…
Q: Which primer would be appropriate to amplify the top strand of the DNA molecule shown? 5'…
A: Polymerase chain reaction is a method widely being used to make multiple copies of the same DNA…
Q: The sequence below (A) was read from the autoradiogram (B). (A) 5'…
A: Note: since you have asked multiple unrelated questions, as per the honor code we are answering the…
Q: Describe two similarities and one difference between RNA polymerase and DNA polymerase Your answer…
A: RNA and DNA polymerase III are used in synthesizing nucleic acids . DNA polymerase has proofreading…
Q: What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGELLGTATAL -5…
A: DNA replication :- It is the formation of a new DNA from a pre existing DNA. The DNA so formed is…
Q: Please explain the full DNA synthesis process
A: DNA synthesis occurs when a cell divides, in the process known as replication. DNA replication is…
Q: Using a diagram, and 3-5 sentences, explain the relationship between cell immortality and telomerase…
A: Each time a cell divides, the telomeres get shorter. Telomeres are a region of repetitive nucleotide…
Q: Restriction mapping of the delta chromosome I need help with question two please
A: the mean size is close to 4000 bp. DNA fragments of this length are useful in the lab, since…
Q: Can you please check my answer and make sure it is correct. Question: Describe the two roles…
A: Primers provide specificity for amplification of the target sequence. They are typically 18-30…
Q: DNA polymerase functions from 5’ to 3’ direction. Explain this sentence. You
A: The DNA has been unraveled and unzipped. The helical structure has been unraveled. Special chemicals…
Q: C. Deepen (Pagpapalalim ng Kaalaman) Let us practice decoding DNA! Fill in the complimentary DNA…
A: DNA is what codes for all the cellular genetic information on earth . All cellular life forms from a…
Q: The process by which base pairs combine with each other to form a strand of DNA is called _______.…
A: DNA is composed of four types of nucleotide, adenine, guanine, thymine and cytosine. Adenine pair…
Q: what is the Jusage of DNA separation in gel olootronhorocic
A: Gel Electrophoresis is used to separate macromolecules like DNA and RNA by their size, or proteins…
Q: Think about ONE possible consequence with a brief explanation if the primers were not removed after…
A: Introduction: DNA is a genetic material that defines every cell. Before a cell duplicates and is…
Q: Order the following steps according to the Sanger sequencing method The bands in the electrophoresis…
A: DNA sequencing is a technique used to evaluate the exact nucleotide bases , their position as well…
Q: TAG, TA, and TGA are stop codor
A: 4) The 5' cap is added to the first nucleotide in the transcript during transcription. The cap is a…
Q: Sall Kpnl Kpnl 450 600 200 400 1650 1. If you were to subject this digested DNA to agarose gel…
A: Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: explain the relevance of a chi-square test in genetics
A: The branch of biological science focusing on the study of variations of genes, genes as a whole, and…
Q: True or False. Each time the genome is replicated, half the newly synthesized DNA is stitched…
A: At the point when a cell divided, it is significant that every daughter cell gets an…
Q: A DNA sample was sent off for Sanger sequencing. The results are shown below. What is the sequence…
A: The Sanger sequencing is also known as the chain termination method, it is a method used to…
Q: Please check the pic. Find out where the divisions between fragments are , the number of fragments…
A: An important enzyme is EcoRI, plays an important role in recombinant DNA technology. These enzyme…
Q: 3. Research and discuss where single-stranded DNA are found.
A: Introduction When a DNA molecule only consists of a single strand contrary to the typical two…
Q: 1. What are the materials used for the polymerase chain reaction? 2. Draw a schematic diagram of…
A: The polymerase chain reaction process is used for the amplification of desired target DNA…
Q: N
A: Recombinant DNA , molecules of DNA from two different species that are inserted into a host organism…
Q: Enumerate and define the steps/processes involved in replication.
A: Replication is the process in which two identical copies of DNA molecules are produced from the…
Q: Replicate the DNA strand AAGGCTAACGGCATTTAACCC. Transcribe the DNA strand AAGGCTAACGGCATTTAACCC.…
A: In most organisms, genetic material is stored in the form of DNA. In humans, each cell's nucleus has…
Q: In STR DNA typing, a typical DNA pattern shows (two, three) bands.
A: In STR DNA typing, a typical DNA pattern shows (two,) bands.
Q: Can you please check my answer and make sure it is correct. Question: List the ingredients of master…
A: Polymerase chain reaction (PCR) is a technique to amplify the DNA. For successful PCR, the following…
Q: Draw an Illustration of the steps and other methods involved in recombinant DNA ( Please make it…
A: Recombinant DNA is a type of DNA that is made up of sequences from various sources. The steps in the…
Q: What is a DNA Ladder?
A: Answer :: 1) DNA or deoxyribonucleic acid is the molecule that contains genetic code of organisms.…
Q: Elaborate on the multidisciplinary applications (at least 3) of Recombinant DNA Technology. Give…
A: The recombinant DNA (rDNA) is an innovation that utilizes enzymes to reorder together DNA sequence.…
Q: Part A Why are most recombinant human proteins produced in animal or plant hosts instead of…
A: Bacteria is a prokaryote and human cells are eukaryotic. There is a significant difference in the…
Q: You are given the following sense DNA sequence:…
A: Solution According to chargaff rule In DNA the Pyrimidine Thymine (T) always pairs with the Purine…
Q: Answer the following questions. 1. List the complementary non-coding DNA sequence. This refers to…
A: The messenger RNA (mRNA) sequence is given, and we are asked to determine the complementary…
Q: In the "Indexing DNA" method of n k-mer table, the maximum number of compares when the k-mers are…
A: The process of indexing a genome is similar to that of indexing a book.
Q: What type of replication must be occurring?
A: The above mentioned experiment resembles the Meselson–Stahl experiment that demonstrates the three…
Q: 384 Answer all the questions below please! Required: At least 3-4 sentences for each answer Write…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: advantages of using larger restriction fragments when constructing a genomic library of human DNA
A: DNA library A DNA library is a collection of cloned DNA fragments containing the gene of interest.…
Q: Rosalind Franklin was unable to calculate the dimensions of the DNA molecule. True False
A: Rosalind Franklin was born in London, England. She was offered at King's College in London for three…
Q: b Two short DNA segments are AGCC and CCGA. Are the two segments identical? Yes No Submit
A: DNA ( Deoxyribose nucleic acid ) is ladder like double stranded structure which comprises of two…
Please use the below DNAs and complete 4 steps question. Thanks1
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 3 images
- For the following DNA sequence along a chromosome answer the following questions: The enzymes are working 5' ATGCATTAGACCACTAGCAT 3' left to right 3' TACGTAATCTGGTGATCGTA 5' 12. Is the top or bottom the leading strand? 13. On the leading strand only, start with a primer that is 5 nucleotide's long and then finish the rest as DNA polymerase would. Give me the entire strand of only the leading strand. 14. What enzyme copies the DNA by adding DNA nucleotides? 15. What enzyme links Okazaki fragments together on the lagging strand?Draw the following strands of DNA5’ C-A-T 3’ as well as the complementary base pairing strand hydrogen bonded to itIt should be drawn in detail, structurally.Below is a picture of a single origin of replication in a eukaryotic cell. 5' 3' 5' 1. On the figure above, Draw out where the following molecules will be located: Helicase; Sliding Clamp, Single Strand Binding Protein. 2. On the right hand side of the dotted line, the replication of which template strand (top or bottom) will be continuous by DNA polymerase? 3. On the left hand side of the dotted line, the complete replication of which template strand (top or bottom) will be more affected by a mutation that causes DNA ligase to be partially functional?
- DNA Replication Drawing Name: Using penci, you will draw a representation of DNA replication along the leading and lagging strands. Follow the directions below, drawing each element in its proper location along the replicating DNA strand. Once you are sure everything is in the correct place, complete your drawing by adding color to distinguish objects as separate. 1. On the diagram below, label the 5 and 3' onds of both parental DNA strands (you can make up which is which) 2 Label the replication fork 3. Draw and label helicase 4. Label the overall direction of DNA replication 5. Draw and label single stranded binding proteins 6. Draw and label the leadng strand 7. Draw and label a single DNA polymerase IIl on the leading strand 8. Draw and label an RNA primer on the leading strand 9. Draw and label a DNA polymerase I on the leading strand 10. On the lagging strand, draw and label at least three Okazaki fragments 11. On the lagging strand. draw and label at least two DNA polymerase IIl…Matching Type Choose the directionality of the given process. (4 points) What is the directionality of the given process? * 4 points 3'-5' 5'-3' Exonuclease activity Complementary strand of the continuous strand Addition of nucleotides going to the replication fork Addition of nucleotides away from the replication fork5'-GCGGTACGTTACGGCTTTACTGACCTGCAGGC-3' A. Convert this to a double strand DNA molecule by writing the complementary sequence. Be sure to correctly label the ends of the double stranded molecule B. Pick one of the two strands and write the sequence of an RNA molecule that could be transcribed from it. Again, you must correctly label the ends of the molecule.
- For the following DNA sequence along a chromosome answer the following questions: The enzymes are working 5' ATGCATTAGACCACTAGCAT 3' left to right 3' TACGTAATCTGGTGATCGTA 5' 13. On the leading strand only, start with a primer that is 5 nucleotide's long and then finish the rest as DNA polymerase would. Give me the entire strand of only the leading strand.AKS 5c: Which student correctly explained what is occurring in the images? AEGCEE ECCUAE FACGAAAGCAEA 3' Met Leu Ser Tyr Tyr Gle Ser le Met Leu Ser Tyr Tyr Glu Ser le The 4th student explains the first arrow must demonstrate how the base pairing rule is being used to replicate a strand of DNA since the complementary pairs are being O lined up for semi conservative replication. The second arrow must demonstrate the process of transcription since the DNA is being read at the ribosomes and the monomers of protein are being connected. The 1st student explains the first arrow must demonstrate how the base pairing rule is being used to replicate a strand of DNA since the complementary pairs are being lined up for semi conservative replication. The second arrow must demonstrate the process of translation since the RNA is being read at the ribosomes and the monomers of protein are being connected. The 2nd student explains the first arrow must demonstrate how the base pairing ruleDate Name Period. DNA: The Molecule of Heredity Worksheet DNA Structure 1. On the diagram to the right: Circle and label a nucleotide. edi Label the sugar and phosphate molecules.MO AMD ad bl Label the bases that are not already labeled.b Label a base pair. ***** 7 wled olunelo Label the sugar-iam phosphate backbones. • Label the hydrogen bonds. lonicinO AMO lonipinO AVO bnot bannte S bhonte 2. A nucleotide is made of three parts: a and a group, a five carbon base. of the 3. In a single strand of DNA, the phosphate group binds to the next group. 4. Chargaffs rule states that the DNA of any species contains equal amounts of and also equal amounts of & & 5. In DNA, thymine is complementary to (or pairs with) complementary to ; cytosine is 6. In a strand of DNA, if the percentage of thymine is 30%, what would the percentage of cytosine in the same DNA strand be? 7. James Watson and Francis Crick with, the help of Rosalind Franklin and others, determined that the shape of the DNA molecule…
- The steps listed below are necessary in order to of copy double-stranded DNA. Place them in order from first to last. Note that all or only a some steps may be used. 1: Synthesis is initiated on the 3-hydroxyl group of the primer. 2: Two strands of a duplex DNA molecule are separated. 3: DNA polymerase makes a DNA chain using an existing chain as a template. 4: A primer base-pairs with the complementary region of the DNA to be copied. 5: A primer base-pairs with the okazaki fragment of the DNA to be copied. 1,2,3,4 4,1,2,5, 3 2,4,1,3 2,4,3,1 3,4,1,2 2,4,3,5,15’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ Fill in the complimentary DNA strand and label the polarity (the 5’ and 3’ ends)nd 2 minutes): Any RNA polymerase in any organism: O A Synthesizes RNA chains in the 3 to-5" direction O B. Binds tightly to a reqion of DNA located thousands of base pairs away from the transcobed rogion of the DNA OC Has proofreading activity O D. Separates DNA strands throughout a long region of DNA (up to tinousands of base pairs) and then copies one of them. OE Has a subunit called A (lambda), which acts as a proofreading ribonuclease OF. Can initiate synthesis of a new RNA chain without a primer