Historial Marcadores Ventana Ayuda0Question 41What is specifically illustrated in the figure below?Self-complementarysequenceRNApolymeraseDNA5' 3'Pつつつ3' 5'RNA transcriptionA(4444Ocarrollcc.instructure.comEdit View Insert Format Tools TableOOHairpin loop(GC-rich)บบบบบบ3′RNAOе12pt ✓ Paragraph | BIUA 2 T²V |V(LD)5'♫tvAA Ċ1 ptsCTA

Name: Historial Marcadores Ventana Ayuda0Question 41What is specifically il
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Historial Marcadores Ventana Ayuda0Question 41What is specifically illustrated in the figure below?Self-complementarysequenceRNApolymeraseDNA5' 3'Pつつつ3' 5'RNA transcriptionA(4444Ocarrollcc.instructure.comEdit View Insert Format Tools TableOOHairpin

In the image shown, we can see two strands of DNA, unwinded, RNA polymerase, RNA being transcribed…

Science

Biology

Question 41 What is specifically illustrated in the figure below? Self- complementary sequence RNA polymerase 2012 Pucation, inc DNA 5' 3' 12pt ✓ Paragraph сссссе DDDDDY 3' 5' RNA transcription UA Edit View Insert Format Tools Table | BIU Hairpin loop (GC-rich) UUUUUU 3' RNA ♫ 5' v T² v tv A

Question 41 What is specifically illustrated in the figure below? Self- complementary sequence RNA polymerase 2012 Pucation, inc DNA 5' 3' 12pt ✓ Paragraph сссссе DDDDDY 3' 5' RNA transcription UA Edit View Insert Format Tools Table | BIU Hairpin loop (GC-rich) UUUUUU 3' RNA ♫ 5' v T² v tv A

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

answer all subpart to upvote because vert short question otherwise dislike Viruses that infect bacteria (bacteriophage) sometimes encode a lysozyme gene in their genome. The gene gets inserted into the bacterial genome and gets expressed in the same way that bacterial genes get expressed. A) What location in the bacterial cell would the gene get transcribed into mRNA? (1 sentence max) B) What protein complex would perform the transcription to produce the mRNA? (1 sentence max) C) Where in the bacterial cell would the gene get translated? (1 sentence max) D) What protein complex would perform the translation to produce the protein? (1 sentence max)
3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’ Write down the mRNA transcript from DNA above.
me e File Content 911 Edit verview....pdf X PDF view Histor Biol 140 X Doordena Content acconline.austincc.edu/ultra/courses/_891351_1/cl/outline X Begin: X O Tutorial X Match each term with its best description. You may use each answer choice more than once. location of transcription in prokaryotes RNA triplet on tRNA which pairs complementary to an mRNA codon to ensure correct amino acid is brought into the ribosome during translation 18 Unit 3 X location of translation in all cells process of rewriting DNA code into mRNA code mRNA triplets which code for a specific amino acid Unit 3 ( x process of converting an mRNA transcript into a seuence of amino acids making up a polypeptide folded RNA that carries amino acids and transfers them to the ribosome during translation makes up ribosomes along with proteins location of transcription in eukaryotes intermediate between DNA and protein interpreted as codons specifying certain amino acids Content Your disk is alme Save space by op A.…
COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC
pcc300ATAAADATATAOOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' al bnsua AMAm pniwollot erfT E transcription s yd bnsita ebitgeqylog s sidmeaze of beae RNA strandUU UAOUOUU A-emoaodin 5'-CGUA AUUGUC UCCUUA- 3' J J JL erit o elinW (s) translation bluow terdt aspnso sigootiwsone polypeptide viemetis ns ebivo19 (d) ent ot etslanT Key:
Name: Date: 2. The sequence of a fragment of one strand of DNA is AATTGCATATACGGGAAATACGACCGG. Transcribe this s sequence into MRNA. er bns eldst eboo oi ebitqeqylog erlt to noihiog eri qu elsm bluow tsri abios onime Jlaw as ye s 1ot noitem atelomet AHG 3. The following MRNA ştrand is being used to asemble a polyp
48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letter
5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this gene
#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ Transcribe the template strand be sure to use the 5’ and 3’ directions appropriately on the mRNA, feel free to rewrite the DNA strand if needed to make it easier to interpret. Make sure to label the mRNA with a "5'cap" and place 10 A's to form the poly-A tail.
intron-Seauence of nueleotides klith in the gene but are r emeved fürm the Ŝeaçuente a final MKNA moleciles Is made. 31. How does an RNA molecule get modified (what part is kept and what molecules are used, what gets added on)? before
40 Shown below is the antisense strand of DNA. What is the amino acid sequence that corresponds to this code? 5' AAAGCATACCGG 3' Second letter G. UUU Phe UCU UAU) Tyr UGC Cys UGU UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUA UCA UUG Leu UG CAU His CGU CGC CGA CGG CU CUU CUC CUA CUG CAC Pro Leu Arg CCA CAA) Gin CCG CAG AAU AUU AUC lle AUA AUG Met ACG ACU AGU AAC Asn AGC Ser ACC ACA Thr AAA1 AGA AAG Lys AGG Arg GAU) Asp GGC GAC Ala GAA GGU GUU GUC GUA Val GCU GCC Gly GCA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a PRO-VAL-SER-PHE PHE-ARG-MET-ALA GLY-HIS THR-LYS d LYS-ALA-TYR-ARG First letter Third letter