Sarah is trying to build muscle, so she wants a high-protein drink, but she is also lactose-intolerant. Which of the following milk products provides the same amount of protein as whole milk, but is also free of lactose? Choose all that apply. 2% Cow's Milk Nonfat Cow's Milk Soy Milk Almond Milk Coconut Milk Lactaid

Sarah is trying to build muscle, so she wants a high-protein drink, but she is also lactose-intolerant. Which of the following milk products provides the same amount of protein as whole milk, but is also free of lactose? Choose all that apply. 2% Cow's Milk Nonfat Cow's Milk Soy Milk Almond Milk Coconut Milk Lactaid

Ebk:Nutrition & Diet Therapy

10th Edition

ISBN:9780357391747

Author:DEBRUYNE

Publisher:DEBRUYNE

Chapter19: Carbohydrate- And Fat-modified Diets For Malabsorption Disorders

Section: Chapter Questions

Problem 9SC

See similar textbooks

Similar questions

People with lactose intolerance cannot digest the common dairy sugar lactose. Besides being careful not to eat dairy foods, is there anything else a lactose-intolerant person can do?
Which of the following best explain lactose intolerance? Inability to digest lactose and causes digestive issues such as cramping and bloating. O Inability to digest maltase and releases excess maltase in the blood. Inability to digest lactose and releases excess lactose in the blood. Inability to produce the maltase enzyme and causes digestive issues such as cramping and bloating
Compare the total carbohydrate (polysaccharides + fiber+ sugars) and sugar (disaccharides and monosaccharides) content of 2% Lactaid vs. 2% regular milk (both pictured). Are they the same or different? Why?
Answer all questions below: Account for the occurrence of lactose intolerance? Account for the distinct advantages of human milk over formula or cow’s milk for infants. Briefly discuss the importance of protein in our bodies? What are the major sources of protein?
1) Is this sentence false or true: 100 grams of fat have the same caloric value as 100 grams of protein.
Lactose persistence is when 1/3 of adults cannot digest lactose. True or false
According to current dietary recommendations, trans fat intake should be limited. How is this best accomplished? Group of answer choices Select foods containing manufactured rather than naturally occurring trans fats. Read labels to select foods that say “polyunsaturated fatty acid free.” Choose foods with <10% of calories from saturated fat per serving and no hydrogenated oils in the ingredients list. Use fat replacers, such as olestra, which provide the same nutrient content as regular fats without being saturated. Avoid all processed foods such as bakery items, packaged cookies, and store-bought bread.
The USDA dietary guidelines recommend that individuals obtain approximately 0.80 grams of protein for each kilogram of body weight. This number should also fall between 10 and 35 percent of total daily calories. Jose weighs 152 pounds, which is a healthy weight for his height. He consumes about 2,200 calories a day. According to these USDA guidelines for daily protein intake, approximately how many grams of protein should Jose consume every day? (Remember that 1 kilogram = approximately 2.2 pounds)
Using the macronutrient info, how many Calories do you expect to see (per serving) for this product? Assume the dietary fiber does not add any Calories. Nutrition Facts 32 servings per container Serving size 1 1/4 cup (28g) Amount Per Serving Calories % Dally Value Total Fat 8g Saturated Fat 1g 10% 5% Trans Fat 0g Cholesterol 0mg 0% Sodium 680mg Total Carbohydrate 23g Dietary Fiber 5g Total Sugars 4g Includes 5g Added Sugars 30% 8% 18% 10% Protein 5g 10% Not a significant source of vitamin D, calcium, iron, and potassium • The % Daily Value (DV) tells you how much a nutrient in a serving of food contributes to a daily diet. 2,000 calories a day is used for general nutrition advice.
The following shows the lunch’s and dinner’s menu of Mary: Lunch: Sweet & Sour Deep Fried Chicken with White Rice Dinner: Burger with Bacon and Cheese served with Fries (a) What is the health concern of this menu in term of fat content if Mary always has this menu?(5 marks) (b) List out the food items in the above menu which are protein food group. According to MyPlate, what are the recommendations for the intake of Protein group? (5 marks) (c) If Mary always faces the problem of constipation, suggest some ways to modify the above menu in order to prevent constipation with explanation. (10 marks) (d) Mary likes to use lot of soy sauce and salt to cook. Suggest at least 3 ways with examples for Mary to reduce the risk of high sodium intake in her diet. State the risk of high sodium intake in the diet. (10 marks)
Whenever a person consumes dairy products, they utilize lactase enzymes to break down the disaccharide carbohydrate, lactose into monosaccharides: galactose and glucose. Overtime, these enzymes become worn and need to be replaced. The following DNA sequence contains the information needed to build more lactase enzymes: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ 5’ – TGGAGAATGAAAATATATATCCCTTCTGATTAACAG– 3’ Which strand is the template strand?
Carbohydrate (True or False) 1. linked to lipids in hormones 2. contains C=O 3. linked to proteins in the cell membrane 4. provides energy in the form of glucose 5. possesses HC=O linked to lipids in hormones contains C=O linked to proteins in the cell membrane provides energy in the form of glucose possesses HC=O