Table 2. DNA Sequence 2 from Lactose-Tolerant and -Intolerant Individual Individual A IV-3 Phenotype Sequence Copy 1, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 1, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACACTCTTGACAA BIV-4 B IV-8 Copy 1, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACGCTCTTGACAA Copy 1, Chromosome 2: ATAAAGGACGCTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACGCTCTTGACAA Copy 1, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 1, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACACTCTTGACAA BIV 9 CIV-3 D IV-4 2. Identify and highlight all the nucleotides that differ between at least two sequences in each table.

Table 2. DNA Sequence 2 from Lactose-Tolerant and -Intolerant Individual Individual A IV-3 Phenotype Sequence Copy 1, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 1, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACACTCTTGACAA BIV-4 B IV-8 Copy 1, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACGCTCTTGACAA Copy 1, Chromosome 2: ATAAAGGACGCTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACGCTCTTGACAA Copy 1, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 1, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACACTCTTGACAA BIV 9 CIV-3 D IV-4 2. Identify and highlight all the nucleotides that differ between at least two sequences in each table.

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter8: Dna Structure And Function

Section: Chapter Questions

Problem 15SQ

See similar textbooks

Similar questions

#1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Why is 26 incorrect
Arial BIUA 11 + .. | I 1 I 3 I 4 i.) Fill in the table for each of the E. coli: (0) = No Activity (+) = Basal Activity and (+++) = High Activity E. coli chromosome F' Plasmid B-gal activity? Permease activity? When When When When Glucose is Lactose is Glucose is Lactose is present present present present a.) I+ P+ O+ Z+ Y+ Inone +++ +++ b.) I^[S] P+ O+ Z+ Y+ none c.) I+ P+ O^[c] Z+ Y+ none d.) I+ P+ O- Z- Y+ none e.) I+ P+ O+ Z+ Y+ I^[S] P+ O+ Z+ Y+ f.) I^[S] P+ O+ Z- Y+ I+ P+ O^[c] Z+ Y- g.) I^[TB] P+ O+ Z+ Y 1+ P+ O^[c] Z- Y+ h.) I+ P+ O^[c] Z+ Y- I+ P+ O+ Z** Y+ i.) I^[TB] P+ O^[c] Z+ Y- 1+ P+ O+ Z- Y+ Z** is a polar mutation ii. ) If the lac operon in 'a' carried a mutation in the CAP binding site that rendered it nonfunctional, how would that affect the level of ß-galactosidase protein activity with and without lactose present, why? MacBook Air 000
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Information obtained by microscopic analysis of stained chromosomes is used in: radiation hybrid mapping sequence mapping RFLP mapping cytogenetic mapping
/take S. pyogenes may contain deoxyribonuclease. What is the role of this enzyme? Deoxyribonuclease facilitates the production of DNA from bacterial cells. Deoxyribonuclease is an enzyme that replicates DNA and then proteins. O Deoxyribonuclease breaks down proteins and damages the cell. O Deoxyribonuclease breaks down DNA released from damaged cells. Question 4 Which organism can produce pyocyanin? MacBook Air
Caculate the concentration of DNA of each tube (1-8) at the end, including the unkown. The DNA concentration is 1.5
Following is the data and notice that it is a terrible idea to culture hMSCs longer than 10 days. You’re strongly Days # cells0 50001 75002 125003 125004 218005 287006 530007 1143008 1653009 19200010 19200011 11680012 8950013 8830014 78300 Part1 You are working for a start-up that is pursuing a clinical trial. The trial involves grafting hMSCs intopatients suffering from interveterbral disc disease using a degradable polymer scaffold. You are going to 3Dprint a porous cylindrical scaffold that is 2 cm in radius and 1 cm in height (matching the dimensions of adegenerated disc). Assume a porosity of 50%. You will fill available volume of the scaffold with hMSCs at adensity of 1 million cells per cm3. Based on the data above, what starting number of cells will you use andhow long will it take you to get enough cells for the trial? Part2The trial is a failure (patients did not report any reduction in back pain). Your team wants to try againusing 85% hMSCs and 15% nucleus pulposus cells .…
E Samu E Samu FAIPQLSCDH_No2]MEaHUdrt5NWa2uY6AaKa7Bhy4xfhwplF-CsVAbyA/formResponse Gmail YouTube O Maps Which model below accurately depicts the process of mitosis? * 2n 2n 2n Option 1 Option 2 2n 2n 2n 2n Option 4 Option 3
Why is the company Qiagen has more refined DNA extraction steps than a normal Strawberry DNA extraction practical? Summary of Qiagen DNA extraction steps Add ATL buffer and grind with sample. Add 20 microliters of enzyme Proteinase K to degrade protein into a 1.5-2ml microcentrifuge tube. Add 200 microlitres AL lysis buffer, and mix by vortexing for 5–10 seconds, which breaks cell membrane allowing DNA to be released. Incubate the sample at 56 degrees for 10 minutes. Mix the cell lysate with 200 microlitres ethanol by pipetting it at the side of the microcentrifuge wall so DNA precipitates. The DNA forms a white layer and the remaining liquid is discarded. Pipet the mixture into DNeasy Mini spin column placed in a 2 ml collection tube. Centrifuge for a minute at 8000 rpm. Place the mini spin column into a 2 ml collection tube, add 500 µl Buffer AW1, and centrifuge for 1 min at 8000 rpm. Then add it to a new 2 ml collection tube (provided), add 500 µl Buffer AW1, and centrifuge for 1…
Across 12. 9.) one of two idéntical halves of a replicated chromosomes 15 17 12.) the structure that forms during cytokinesis in plants separating the two daughter cells 8 9. 10 13.) the condition of halving more than two sets of chromosomes per. 11 12 13 |14 Down 4.) the complex of DNA and prótein that makes up eukaryotic chromosomes 15 16 17 18 5.) the condition of having one set of chromosomes (n) per nucleus 19 20 7.) the chromosome complex formed by the synapsis of a pair of homologous 4.