The mismatch DNA repair mechanism is based on the fact that: O a. O b. O C. O d. The parental DNA strand is recognized because it is structurally distorted. The parental DNA strand is methylated while daughter strand is not. The daughter DNA strand is recognized because it is structurally distorted. The daughter DNA strand is methylated while parental strand is not.
Q: HOW MANY of the following five items represent modes of protein denaturation? 1.) heating a protein…
A: Proteins are biomolecules composed of amino acids. Amino acids are joined together through peptide…
Q: Name the primary sources of ATP for: a. Immediate energy for a few seconds b. Energy extending to…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP: the energy…
Q: 1. Compute the concentration of the standard solutions by completing Table B.1. Report your answers…
A: Bradford assay is a method to estimate the protein concentration in the given sample. It is based on…
Q: 4. The figure below shows ATP in the binding site of pyruvate kinase, an important enzyme cellular…
A: Pyruvate kinase is the enzyme that catalyses the conversion of phosphoenolpyruvate to pyruvate. It…
Q: Tay-Sachs disease is result from a)malfunction of cerebroside metabolism b)the accumulation of GM2…
A: Tay Sachs disease is a recessively inherited genetic disease. It is characterised by the destruction…
Q: A characteristic of complex III is that it is reduced by FADH2. participates in electron transfer…
A: ETC consist of four protein complexes called Complex I, II, III and IV that transport electron…
Q: A 6-year-old boy is brought to the physician by his mother because of intermittent upper abdominal…
A: INTRODUCTION : Serum Chylomicron & its increased concentration - For the transportation of…
Q: 1. Define a polynucleotide. 2. What are the types of polynucleotides? 3. Enumerate and classify all…
A: Nucleotides are the complex compounds made up of nitrogen base, a sugar residuw and a phosphate…
Q: He is administered a drug that inhibits bacterial enzyme that catalyzes bacterial DNA synthesis. The…
A: Enzyme inhibition is a process by which the activity of an enzyme is altered. Inhibitors are…
Q: Which of the following statements about the TCA cycle is INCORRECT? O a. The TCA cycle can recover…
A: An inventive set of eight reactions makes up the TCA cycle. It is a crucial route that uses a…
Q: Using a Venn include when
A: DNA replication is a vital biological process of producing identical copy of DNA using enzymes DNA…
Q: What is the function of CTAB being added to the cell culture before performing the enzyme induction…
A: Cell culture is the propagation of cells by providing a controlled physiological and physicochemical…
Q: Why might a person who is gravely ill not want to participate in a placebo-controlled drug study?
A: Placebo-controlled drug study is a study done where one group of participants are given the actual…
Q: 1 enzymes are a class of proteins that catalyze biochemical reaction.what are ribozymes? 2 what is…
A: Enzymes are usually composed of proteins which catalyzes biochemical reactions by decreasing the…
Q: What are the qualitative tests to characterize isolated RNA?
A: RNA or ribonucleic acid, most often single stranded nucleic acid found is all living organisms is…
Q: Based solely on the amount of NADPH produced, what is the total number of photons of light that must…
A: In the photosystems, NADPH is produced by a series of reactions starting from absorption of photons.…
Q: A) List each of the five major functional classes of proteins. B) Discuss the function for each…
A: Amino acids are what makeup proteins. Protein structures are biopolymeric. Twenty amino acids are…
Q: Following data were obtained in a study of enzymatic reaction that follows the Michaelis Menten…
A: 1. Km is the substrate concentration at which the Vmax is half. Km (concentration of substrate) =…
Q: Match the protein subunit with the correct functional component of the yeast ATP synthase complex in…
A: ATP synthase has two parts-Fo and F1. The Fo is bound to inner mitochondrial membrane whereas the F1…
Q: "Implementation of PAT system in manufacturing of pharmaceuticals results in less validation and…
A: The term 'Process Analytical Technology' or 'PAT' was coined by the pharmaceutical industry and IPQC…
Q: Denatured protein is in a low energy state. What sort of explanation can you use to rationalize that…
A: Denaturation of protein: When proteins are denaturized, they lose the quaternary, tertiary, and…
Q: Muscle glycogen phosphorylase, an enzyme that provides glucose to the muscle for energy production,…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: The citric acid cycle is shown. The methyl carbon in acetyl CoA is labeled with C14C14 (shown in…
A: Carbon tracing is a biochemical technique of tracking the path taken by a specific carbon atom in a…
Q: What are the components of cephalins? Glycerol Two fatty acids Phosphoric acid Serine All of the…
A: Lipids are a very important class of biological molecule. Lipids can be classified into 2…
Q: In the first stage of glycolysis, the hydroxyl group on C6 of glucose is phosphorylated to form…
A: Glycolysis is takes place in both the cells aerobic and anerobic as it does not utilize oxygen to…
Q: please explain how to solve this type of questions
A: Each amino acid's preference for the alpha or beta secondary structure can be estimated. The…
Q: could you please write the equation on paper with pen? I cannot understand the equation clearly.
A: The competitive inhibitors are the molecules which inhibits the enzyme catalyzed reaction by binding…
Q: Calculate the number of moles of ATP produced from the complete oxidation of 900 g glucose in the…
A: Glucose that enters the cell produces ATP by respiration. The processes involved are glycolysis,…
Q: With regards to hemoglobin-oxygen binding, CO2 is a [Select] modulator and 2,3-bisphosphoglycerate…
A: Positive allosteric modulators of haemoglobin -oxygen binding are the agents that stabilise R state…
Q: Draw the complete electron pushing mechanism for the reaction.
A: Oxidation of glucose into pyruvate followed by oxidation of pyruvate into acetyl CoA and then…
Q: Virtually all animal cells have a Na+/K+ pump. Which of the following statements concerning it is…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: A patient on dapsone begin to experience dizziness and vertigo 3 days after taking his medication.…
A: Cyanotic defects: Cyanosis is a condition caused by cyanotic defects, in which the blood pumped to…
Q: How does insulin cause an increase in the rate of glucose transport into cells when blood glucose…
A: Insulin is a peptide hormone that helps to maintain the glucose levels in the blood. When there is…
Q: Once AMP and GMP are synthesized, they are then converted to ADP and GDP, then to ATP and GDP. What…
A: Adenosine & Guanosine are purine nitrogen bases. To these phosphate groups are attached. AMP…
Q: what is does the induced -fit model account for? 2 why are most enzyme inactive at higher…
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Q: In one form of thalassemia, the mutation of a single base from G to A generates a new 3' splice site…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: Elaidic acid is an 18 carbon fatty acid with a trans double bond at carbon 9 that is produced in…
A: The major physical property of fatty acid is their melting point, which in-turn define at which…
Q: H3N. Amino acids are bonded together in a linear polymer to form peptides or proteins. A small…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: Provide the principle of biuret test used to detect RNA. Explain in 5 sentences essay
A: The biuret test is used to detect substances that have peptide linkages. To evaluate the aqueous…
Q: In an enzyme mechanism that generates a negative charge in the transition state, which of the…
A: When a substrate(S) binds to the active site of an enzyme(E), it leads to the formation of an ES…
Q: What are the Essential and Non-Essential Amino Acids? Describe each.
A: An amino acid is an organic compound that contains both an amino (-NH2) and carboxylic acid (-COOH)…
Q: Why do we need to determine the extinction coefficient in order to calculate the initial velocity in…
A: Enzyme are proteins that catalyse biochemical reactions. A substrate binds at the active site of the…
Q: Given the data in the table below and your knowledge of the "chemical standard state" (X) and the…
A: Chemical standard state is defined by standard conditions in chemical systems. These standard…
Q: Compare and contrast glycerophospholipids and triacylglycerols(functions, structure), including…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: What is the committed step of pyrimidine biosynthesis? Include the names and structures of any…
A: Pyrimidines are nitrogenous bases found in nucleic acids. Pyrimidines are heterocyclic organic…
Q: Please depict a noncovalent interaction important for the function of lysozyme
A: The enzyme lysozyme aid in the breaking down of polysaccharides in the bacterial cell membrane. They…
Q: 1. Determine the molecular properties of amino acids; - what happens to the protein folding pattern…
A: "Since you have asked multiple questions, we will solve the first two questions for you. If you want…
Q: Which of the following liver metabolic pathways are not normally active at the same time but are…
A: Cortisol : This is steroid hormone that increases blood glucose levels. it decreases glucose uptake…
Q: Considering that 21.8 kJ/mole of energy is required to transport 1 H+ across the mitochondrial…
A: Aerobic metabolism of 1 molecule of glucose can produce 10 NADH (6 from acetyl CoA in the TCA cycle…
Q: Which enzyme regulates the rate at which acetyl-CoA enters the citrate cycle? isocitrate…
A: INTRODUCTION:The primary function of the citrate cycle is to. convert energy available from the…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Match the bold DNA repair response(s) to the triggering type of DNA damage. Homologous Recombination Mishmatch Repair Base Excision Repair Nucleotide Excision Repair Non-homologous End Joining Single-strand DNA breaks Removal of repair lesions such as photoproducts caused by UV including Thymine dimers Double-Strand Break repair mechanism which is an accurate repair mechanism without any introduction of insertions or deletions. It requires a sister chromatid as a template. This repair mechanism uses just DNA glycosylase to remove Uracil (no other enzymes or complexes are required) then DNA polymerase can use the template stand to add the complementary base where the Uracil has been removedInterstrand Crosslink Repair This repair mechanism is used to recognize and repair mis-incorporation of base that can arise during DNA replication. Removal and replacement of modifying bases such as Uracil, 8-hyroxyguanine and others. Double-strand Break that is termed as “Quick and Dirty” as it is…Describe the genetic roles of DNA helicase and DNA polymerase. Contrast the function of DNA polymerase with thatof RNA polymerase.An intermediate step in a novel genome editing tool called "base editing" produces DNA strands with the following nucleotide pairing: T G The final step in "base editing" requires the cell's normal DNA repair machinery to correct the pairing shown above. Given your knowledge of DNA repair, name the repair pathway that would act on the DNA molecule above, and describe all of the steps and proteins involved in this repair pathway. (Hint: Since DNA replication has already been completed in this case, "proofreading" is not the correct answer.)
- Which of the following DNA repair processes is known to be "error-prone" (i.e. resulting in incorporation of incorrect nucleotides as part of the repair process)? Mark all the answers that are correct. post-replication repair Nucleotide Excision Repair (NER) M non-homologous end-joining of double-stranded DNA breaks. SOS-response O Base Excision Repair (BER)Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…During cellular checkpoints DNA Repair Proteins can edit and patch our DNA through many different repair mechanisms. What two kinds of repair are there for Double Stranded DNA breaks?
- During replication of a DNA molecule, the daughter strands are not produced in exactly the same manner. One strand, the leading strand, is made continuously toward the replication fork, while the lagging strand is made in fragments in the opposite direction. This difference in synthesis of the two strands is the result of which of the following? O a. DNA polymerase is not efficient enough to make two "good" strands of DNA O b. The two template strands are antiparallel, and DNA polymerase can only synthesize DNA in the 5' to 3' direction O c. The lagging strand is the result of DNA breaks caused by exposure to UV light Od. The cell does not contain enough nucleotides to make two complete strands Oe. Both B&DDNA repair enzymes preferentially repair mis- matched bases on the newly synthesized DNA strand, using the old DNA strand as a template. If mismatches were instead repaired without regard for which strand served as template, would mismatch repair reduce repli- cation errors? Would such a mismatch repair system result in fewer mutations, more mutations, or the same number of mutations as there would have been without any repair at all? Explain your answers.What is/are the attributes that make nucleotide excision repair (NER) and base excision repair (BER) similar and/or different from each other? Select the correct response: The NER pathway is the only one that can remove DNA lesions in the strand regardless of their size which is followed by attaching the correct strand, then sealed by a DNA ligase. They both use the enzyme DNA glycosylases that recognizes the damaged DNA segments and proceed with repairing the faulty base in the strand. They differ NER only repairs purine bases while BER repairs pyrimidine bases. They both remove the damaged parts of the DNA where the BER pathway corrects only the identified damaged bases which are usually non-bulky lesions. The NER pathway, on the other hand, repairs the damage by removal of bulky DNA adducts which is a short-single stranded DNA segment. They both utilize the enzyme photolyase to reverse the damages created by the faulty section of the DNA. They both remove the damaged parts of the…
- Please explain one type of “DNA repair” mechanism (what is it, when is it used, how does it work).1) The function of ligase is to seal nicks in the backbone of a DNA strand. The function of AP endonuclease is to create a nick in the backbone of a DNA molecule adjacent to an apurinic site, which allows DNA polymerase II access to the DNA to repair the damage and prevent a mutation resulting from the use of a damaged or erroneous strand of DNA as template during DNA replication. Why doesn't ligase simply seal up the nicks the AP endonuclease introduces before DNA pol II can do anything?List six types of DNA repair. Explain the basic features of each.