What is the role of his119 in the RNase-catalyzed hydrolysis of RNA, as indicated inthe Figure below?RNA-0-CH₂ Q BaseHis 119H HNHHis 12-P-0-CH₂ a BaseH H3'HO2'O-HOHO-0-P=0It acts as a general base, abstracting a proton from the 2' hydroxyl in order toincrease its nucleophilicity.It forms an H-bond with his12 in order to stabilize the transition state.It serves as a general acid, donating a proton to improve the quality of theleaving group.It works through concerted general acid-base catalysis with his 12 in order tofavour the products of the reaction.Two of the above are true.

Enzyme are proteins that catalyse biochemical reactions. The substrate binds to active site of the…

Answered: What is the role of his119 in the…

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter26: Synthesis And Degradation Of Nucleotides

Section: Chapter Questions

Problem 6P: Allosteric Regulation of Ribonucleotide Reductase by ATP and Deoxynucleotides Describe the...

See similar textbooks

Similar questions

Suggest a reasonable strategy for the specific phosphorylation of the5’ –OH group of a nucleoside.
E. coli ribonuclease H1 is an enzyme that catalyzes the hydrolysis of phosphodiester bonds in RNA. Its proposed mechanism involves a 'carboxylate relay,' as shown below. His124 Asp70 || -HN-CH-C -HN-CH-C- CH2 CH2 c=0 RNA substrate HN H. H. (1) Fill the blanks. In the reaction scheme above, His124 acts as a ( ). The purpose of this relay system is to deprotonate the water molecule (II) so that it becomes a better ( :0
The enzyme cytidine deaminase catalyzes the conversion of cytidine to uridine. Cytidine deaminase catalyzes the reaction through an addition of water across the cytidine 3,4-bond, forming a tetrahedral intermediate followed by the elimination of NH3 to form the product uridine. This is like the addition-elimination mechanism that we studied for adenosine deaminase. Cytidine deaminase НО. NH₂ N пOH OH cytosine R + H₂O cytidine The Km value for the substrate cytidine is 2.5 × 10-4 M, and the K; for competitive inhibition by the product uridine is 2.5 × 10-³ M. N R A reduced derivative of the product, 3,4,5,6-tetrahydrouridine was shown to be a fully reversible competitive inhibitor with a Ki of 2.4 x 10-7 M, a value approximately 10,000 times lower than that of the product uridine. NH₂ NH uridine HO. N R R = D-ribose HOH OH uridine 3NH uracil ring numbering H NH H H + NH3 H OH H 3,4,5,6-tetra- hydrouridine a.) Draw a structure of the intermediate that we predict to form during the…
Given the following diagram of how protein AWESOME1 binds to it's target DNA, describe the potential effects of each of the 5 mutations shown below. The wild-type sequence of a helix #1 is also shown in the blue box, and all the mutations are in helix #1 (see numbers for identifying particular residues). a helix #1 R(1)-V-I-L-Y-F-W-I-M-Y-F-S-H-Y-W-R(16) #1 Predict the consequence of the following mutations: 1) Arg(1) to Glu 2) Arg(1) to Ala 3) Phe(6) to lle 4) Trp(7) to Phe 5) Met(9) to Pro in
(c) On the right is a diagram of the ac tive site of E. coli aspartate aminotrans- ferase illustrating the cofactor pyridoxal phosphate (labeled PLP) with the dicar- boxylic acid maleate (labeled MAL) bound in the active site. The structural formula of maleate is shown on the right. Am 194 MAL Arg292 Arg386 Ilx17 Lauf 'coo- H get H Coo- Maleate (c1) Draw the structure of L-aspartate and draw a border around the atoms in the amino acid that maleate simulates. (c2) Identify the active site residues that make hydrogen bonds and electrostatic interac- tions with the oxygen atoms of the carboxylate groups of maleate in the diagram above. Identify the carboxylate groups according to the numbering in the diagram of maleate above. Indicate the hydrogen donor groups of the active site residues. (C3) Compare and draw the structures of L-Arg and L-Lys. On the basis of the diagram why does replacement of an arginine for a lysine have an effect on substrate binding to AspAT? (c4) Of the mutant…
Consider the following polypeptide sequence: Gly Val Tyr Ile Val Asp His Phe Thr Gly Asn Tyr Ala Leu Met Glu Asp Lys Aps Val Val Ala Tyr Glu His Ala Pro Lys Leu Asp Asp Phe Val Glu Glu Ala Ley Lys Val Glu Ala Gly Glu Val Pro Ala Ala Pro A) List the expected fragments that will result from proteolytic degradation with trypsin. B) List the expected fragments that will result from the reaction with CNBr. C) List the first three amino acids that will be identified by Edman degradation in the fragments generated in B).
Treatment of a polypeptide by 2-mercaptoethanol yields two polypeptides that have the following amino acid sequences: Ala-Phe-Cys-Met-Tyr-Cys-Leu-Trp-Cys-Asn Val-Cys-Trp-Val-Ile-Phe-Gly-Cys-Lys Chymotrypsin-catalyzed hydrolysis of the intact polypeptide yields polypeptide fragments with the following amino acid compositions: (Ala, Phe) (Asn, Cys2, Met,Tyr) (Cys, Gly, Lys) (Cys2, Leu,Trp2,Val) (Ile, Phe,Val) Indicate the positions of the disulfide bonds in the original polypeptide. I don't understand how the order of amino acids in Step 2 was arranged. Please explain. Thank you.
Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3 O met-ala-phe-lys-stop O met-ala-phe-lys- met-tyr-his-gly-val-stop-met-gly O met-ala-ser-gly-thr-stop O tyr-his gly-val-stop-met-ly O ala-phe-lys stop
Treatment of a polypeptide by 2-mercaptoethanol yields two polypeptides that have the following amino acid sequences: Ala-Phe-Cys-Met-Tyr-Cys-Leu-Trp-Cys-Asn Val-Cys-Trp-Val-Ile-Phe-Gly-Cys-Lys Chymotrypsin-catalyzed hydrolysis of the intact polypeptide yields polypeptide fragments with the following amino acid compositions: (Ala, Phe) (Asn, Cys2, Met,Tyr) (Cys, Gly, Lys) (Cys2, Leu,Trp2,Val) (Ile, Phe,Val) Indicate the positions of the disulfide bonds in the original polypeptide.
Draw the structure of the dipeptide Gly-His in its fully protonated form. Gly-His Select / Draw C H N Templates O More Erase + 2 Q
Which of the following sequences represents a recognition site for N-linked glycosylation where X is any amino acid residue? Gln-X-Ser O His-X-Ser O Arg-X-Ser O Asn-X-Ser O Asp-X-Ser
What is the significance of the pentose monophosphate shunt to synthesis of nucleotides? What is a difference between synthesis of purine and pyrimidine nucleotides?

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS