Write a program which reads a line of text and stores it in a file. Read the text from the file and find the following : Total number of characters Total number of vowels Total number of numerals Total number of words in that text
Q: Write a program that reads in words from a file and prompts the user for another word. Print the…
A: // word, to be searched in a file string word; Then, find out the longest word from the…
Q: 5. Write a program that checks whether a sequence of HTML tags is properly nested. For each opening…
A: using linked list Linked list is a linear data structure in which elements are not stored at…
Q: remove all the occurrences of a specified string from a text file. In Python
A: Algorithm: Step 1: Start Step 2:. INPUT a string Step 3: INPUT character to remove its occurrence…
Q: Write a python program that asks the user how many words they would like to write to a file, and…
A: A python program that asks the user how many words they would liketo write to a file, and then asks…
Q: Create a program that takes in two strings as arguments – the source and destination filenames,…
A: The scanner is a java API class that is used to read data from either the keyboard or from the file.…
Q: Create a program that reads in a word from the user and counts the number of occurrences of that…
A: The code snippet in C++://header…
Q: Write a program that reads the student information from a comma separated values (csv) file. The…
A: Required:
Q: Create a program that calculates the average test scores. Given the student’s name and five test…
A: Problem Statement: Create a program that calculates the average test scores. The data is input from…
Q: Write a program that first reads in the name of an input file and then reads the file using the…
A: import csv# to store wordswords= []# openfilewith open('input1.csv') as f: for row in…
Q: xt file of names, (3 names per line, 5 lines in total) followed by an age for each name. Go through…
A: input.txt Smith 25 kevin 65 Hank 54Tom 98 Ben 96 Denver 63John 52 Gandia 63 Tokeyo 29Lebaon 36…
Q: Write a program that first reads in the name of an input file and then reads the file using the…
A: Here, Code instruction is given.
Q: Write a program that reads a file one character at a time and prints out how many times each of the…
A: File name: “Vowels.java” import java.io.FileInputStream; import java.io.FileNotFoundException;…
Q: Write a program that reads the scores from numbers.txt a line at a time and displays their total and…
A: Please check step 2 for the code. the code is 100% perfect and would work if you paste and execute…
Q: Write a program that will read in a file of student academic credit data and create a list of…
A: The Java program is written where it takes the input student file and add the GPA function to the…
Q: Write a program that first reads in the name of an input file and then reads the file using the…
A: Step 1 : Start Step 2 : Import the csv module and declare the freq dictionary. Step 3 : Take user…
Q: 1. Write a program that reads a file consisting of students' test scores in the range 0-200. It…
A: Save the text file with the name of “score” and make sure that its extension should be “.txt”. Save…
Q: Write a program that reads a file containing two columns of floating-point numbers Prompt the user…
A: import java.io.BufferedReader; import java.io.BufferedWriter; import…
Q: Write a program that opens a text file called quiz.txt for reading. This file contains a single line…
A: Note: Programming language is missing in the question. So we will answer this program in C++. If you…
Q: Write a program that removes all the occurrences of a specified string from a text file. For…
A: This program is done with java file operations. So initially reading the file arguments from the…
Q: Write a program that first reads in the name of an input file and then reads the file using the…
A: According to the Question below the solution: Output:
Q: Write a program that first reads in the name of an input file and then reads the file using the…
A: Algorithm : Step 1 : initialize filename and create empty list and dictionary. Step 2 : open and…
Q: A program that will read line of a stream of integers from a FILE. Reverse each number and compute…
A: SUMMARY: -Hence, we got the output.
Q: Write a program that first reads in the name of an input file and then reads the file using the…
A: Write a program that first reads in the name of an input file and then reads the file using the…
Q: Create a program that reads the text file called "data.txt". Column O contains the patient number…
A: NumPy is the python built-in package that has the functions to create an array and multidimensional…
Q: Write a program that reads lines of characters froma text file and writes each line as a UTF string…
A: The java program is: import java.io.*; class Exercise17_04 { public static void main(String[]…
Q: Python Write a program that first reads in the name of an input file and then reads the file using…
A: #here is my python program import csv #imported the csvd={}# dictionary declaration with…
Q: Write a program that reads the scores from numbers.txt a line at a time and displays their total and…
A: We will read from the file and loop till end of file and have a counter to count no of elements then…
Q: Write a program, and store it in a file called Travel Expenses.xlsm, that does the following: (a) It…
A: Macro code is below: Option Explicit Dim firstName As String Dim lastName As String Dim nMiles…
Q: Write a program that first reads in the name of an input file and then reads the file using the…
A: CODE:- import csv n = input()with open(n, 'r') as myfile: Reader = csv.reader(myfile,…
Q: In c++,Write a program which reads from a file all digits and prints the largest number which is a…
A: Include the header files In main function declare the variables Create a input file stream to read…
Q: Write a program that first reads in the name of an input file and then reads the input file using…
A: def read_file(filename): file = None # open file try: file = open(filename) except: print("Unable…
Q: from Big Java 6th. Edition. Ch.11 P11.12: the capacitor is represented by the equation…
A: PROGRAM: //Importing header file import java.io.*; import java.util.*; import…
Q: Write a program that first reads in the name of an input file and then reads the file using the…
A: Programming instructions: Import necessary header files. Take the file name from the user.…
Q: Write a program that reads a file one character at a time and prints out how many characters are…
A: File name: “Characters.java” import java.io.File; import java.io.FileInputStream; import…
Q: Write a program that will read in a file of student academic credit data and create a list of…
A:
Q: Modify the Total program so that it shows the average, not the total of the inputs. Total.java 1…
A: Modified Program: A modified “Total” program is as follows, File name: “Total.java” import…
Q: Write a program that creates the file "LetterGrades.txt" filled with 1000 randomly generated letter…
A: import random def main(): #create variable for file name fileName = 'LetterGrades.txt'…
Q: Write a program that reads all words from a file and saves them in a data structure. Then, it prints…
A: The idea is to use the concept of File Handling and a text file(say file.txt) that contains all the…
Q: Write a program that will read names, ids, dept names, and cgpa of some students from a file and…
A:
Q: Write a python program that reads the first n lines of a text file. Suppose you have a file with all…
A: Here, Code instruction is given.
Q: Suppose you are given a text file that contains the names of people. Every name in the file consists…
A: Program Approach: Import necessary packages for reading files and writing files ,collections .…
Q: Write a program that removes all the occurrences of a specified string from a text file.For example:…
A: According to the asked question, the solution is given below with a proper explanation.
Q: Write a program that first reads in the name of a input file, followed by two strings representing…
A: Program approach: Input filename, lower bound, and upper bound. Read all lines in the file via…
Q: Write a program that opens a specified text file and then displays a list of all the unique words…
A: Programming language is missing in the question. So we will answer this program in Python. If you…
Q: Write a program that inputs a text file. The program should print the unique words in the file in…
A: First, we are taking an input file name from the user and then opens that file and reads each word,…
Q: Write a program that inputs the names of fifteen cities and stores them in a file city.txt and then…
A: Task: Write a program that inputs the names of fifteen cities and stores them in a file city.txt and…
Q: Write a program that first reads in the name of an input file and then reads the file using the…
A: Open the specified file Then, read row by row and check for each word
Q: Write a program that will countthe number of characters, words, and lines in a file. Words are…
A: import java.io.*; import java.util.*; public class Exercise12_13 { public static void…
It is a complete question.
Step by step
Solved in 3 steps with 2 images
- Program - Python Create a simple text file called mycandy The first line of the file will be Candy Name, Candy Calories, Total Fat Grams Next, add five lines to the file by hand using your favorite five candy bars information. Each line's data will be separated by commas.Write a program that removes all the occurrences of a specified string from a text file.For example: my Aunt went to buy Medicines while Sam and I play Soccer.removes the string Sam from the file. 1) You should create a file with this paragraph. 2) removes the string "John and" from the file.PYTHON!!!!! A file concordance tracks the unique words in a file and their frequencies. Write a program that displays a concordance for a file. The program should output the unique words and their frequencies in alphabetical order. Variations are to track sequences of two words and their frequencies, or n words and their frequencies. Below is an example file along with the program input and output: example.txt I AM SAM I AM SAM SAM I AM Enter the input file name: example.txt AM 3 I 3 SAM 3 The program should handle input files of varying length (lines). Program produces correct output given input, test 1 Test Case: Test program with example.txt Input: example.txt Results: AM 3 I 3 SAM 3 Program produces correct output given input, test 2 Test Case: Test program with test file 2 Input: test.txt Results: 3/4 1 98 1 AND 2 GUARANTEED 1 INDEED 1 PERCENT 1 SUCCEED 1 WILL 2 YES 1 YOU 2
- ### Exercise in Python1 ###\n", "\n", "Open the text oneArt.txt, read the text line by line and, at the end, print the number of lines of text that are in the file. Do not count blank lines."TTODIEMT A straight line can be defined by a pair of points p1(x1, yı) and p2(x2, y2). The slope m of a line is defined as follow: У — Ул x2 - x1 Your program reads the points from a text file called 'points.txt which contains the coordinates of unknown number of pairs of points as shown in Figure 1. Each line contains four values x1, yl, x2, y2, where x1, yl are the coordinates of the first point and x2, y2 are the coordinates of the second point. m 10 -2 7.5 -3.2 4 15.5 -4.6 21 -2 12.5 Зр 5 2 -3 -6 10 3 10 15 Figure 1. Input file contains unknown number of point pairs Use Spider, to create the following files: (i) The input file 'points.txt' shown in Figure 1. (ii) Your Python program that reads from the input file 'points.txť, the coordinates of unknown number of pairs of points, computes the corresponding slopes then prints the results on the screen as shown in Figure 2. ------- Line # x1 Y1 Y2 Slope x2 1 10.00 -2.00 7.50 -3.20 0.48 2 4.00 15.50 -4.60 21.00 -0.64 3 0.00 0.00 e.00…Python A Personal Fitness Tracker is a wearable device that tracks your physical activity, calories burned, heart rate, sleeping patterns, and so on. One common physical activity that most ofthese devices track is the number of steps you take each day The steps.txt file contains the number of steps a person has taken each day for a year. There are 365 lines in the file, and each line contains the number of steps taken during a day. Write a program that reads the file, then displays the average number of steps taken for each month Your program should use a function to calculatethe averagenumber of steps. You will need to pass more than one argument to the function.
- Computer Science C++ Create a text file "input.txt" with a certain amount of integers (you decide how many). Write a program that reads these numbers from the file, adds them, and when you have reached the end of the file, calculates the average of these numbers. Print a message and the average to the console. Code this program twice, demonstrating the two methods to detect the end of the file, part A: reading a value from Instream and storing it (boolean expression) in the while loop part B: using the eof() member functionCode should be in Python. A photographer is organizing a photo collection about the national parks in the US and would like to annotate the information about each of the photos into a separate set of files. Write a program that reads the name of a text file containing a list of photo file names. The program then reads the photo file names from the text file, replaces the "_photo.jpg" portion of the file names with "_info.txt", and outputs the modified file names. Assume the unchanged portion of the photo file names contains only letters and numbers, and the text file stores one photo file name per line. If the text file is empty, the program produces no output. (Examples in image)12. Fibonacci numbers are the numbers in a sequence in which the first three elements are 0, 1, and 1, and the value of each subsequent element is the sum of the previous three elements: 0, 1, 1, 2, 4, 7, 13, 24, ... Write a MATLAB program in a script file that determines and displays the first 25 Fibonacci numbers.
- *Code in Python A file concordance tracks the unique words in a file and their frequencies. Write a program that displays a concordance for a file. The program should output the unique words and their frequencies in alphabetical order. Variations are to track sequences of two words and their frequencies, or n words and their frequencies. Below is an example file along with the program input and output: example.txt I AM SAM I AM SAM SAM I AM Enter the input file name: example.txt AM 3 I 3 SAM 3 The program should handle input files of varying length (lines).The file “dna.seq” (on Blackboard) consists of several DNA sequences. Write a program that reads in the file “dna.seq” and counts the number of sequences with the following properties:• The total number of sequences in the file• The number of sequences that have the pattern CTATA• The number of sequences that have more than 1000 bases• The number of sequences that have over 50% GC composition• The number of sequences that have more than 2000 bases and more than 50% GCcompositionUse pythonThe file "dna.seq" (on Blackboard) consists of several DNA sequences. Write a program that reads in the file "dna.seq” and counts the number of sequences with the following properties: • The total number of sequences in the file • The number of sequences that have the pattern CTATA • The number of sequences that have more than 1000 bases • The number of sequences that have over 50% GC composition • The number of sequences that have more than 2000 bases and more than 50% GC composition Some program requirements: (1) the program should prompt the user for the filename. (2) each of the above tasks should be its own function. dna seg file = CAAAGATTAAGCCATGCATGTCTAAGTATAAGCAATTATACCGCGAAACTGCGAATGGOTCATTAAATCACT TATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGOTAATACATGOTAAAAAGO CCGACTCACGGAGGGTTGTATTTATTAGATTAAAAA