Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 20, Problem 2PDQ
CONCEPT QUESTION
Review the Chapter Concepts list on page 454. All of these refer to recombinant DNA methods and applications. Write a short essay or sketch a diagram that provides an overview of how recombinant DNA techniques help geneticists study genes.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment.
Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers.
Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand).
Please organize your response so that each primer, and associated information, is separated by at least one blank line
5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGAC
Transcriptome analysis involves two separate methodologies: gene expression and RNA seq analyses. The 10 items below are a scrambled listing of the steps used in the two procedures. Identify the steps involved in RNA seq from the list below. Use the numbers in the list to refer to each step. Once the steps for RNA seq have been identified, write the steps in the order in which they are performed during the experiment.
(1) DNA sequencing
(2) Allow for hybridization and wash excess cRNA.
(3) Mix labeled cRNA with array chip.
(4) PCR amplification
(5) Measure fluorescence intensity to determine abundance of transcripts.
(6) Add labeled cRNA at each microarray location.
(7) Map cDNA sequences to the genome of the organism to determine identity and abundance of transcripts.
(8) mRNA isolation from cells
(9) Prepare fluorescently labeled cRNA probes
(10) cDNA synthesis
Explain why DNA ladders are usually included during gel electrophoresis.
One aspect of PCR that can be modified is the annealing temperature. In general, higher annealing temperatures show more specificity towards a single template, whereas lower annealing temperatures show less specificity and may bind to multiple regions throughout the genome. Discuss how using an annealing temperature that is too high or too low might influence the results of a PCR assay (and gel electrophoresis results) such as the one used in this study.
Chapter 20 Solutions
Concepts of Genetics (12th Edition)
Ch. 20 - A plasmid that is both ampicillin and tetracycline...Ch. 20 - You have just created the worlds first genomic...Ch. 20 - What undesirable or unforeseen consequences might...Ch. 20 - Do we have the ethical right to alter the genomes...Ch. 20 - Should these new technologies be regulated...Ch. 20 - HOW DO WE KNOW? In this chapter we focused on how...Ch. 20 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 20 - What roles do restriction enzymes, vectors, and...Ch. 20 - The human insulin gene contains a number of...Ch. 20 - Although many cloning applications involve...
Ch. 20 - Using DNA sequencing on a cloned DNA segment, you...Ch. 20 - Restriction sites are palindromic; that is, they...Ch. 20 - List the advantages and disadvantages of using...Ch. 20 - What are the advantages of using a restriction...Ch. 20 - In 1975, the Asilomar Conference on Recombinant...Ch. 20 - In the context of recombinant DNA technology, of...Ch. 20 - If you performed a PCR experiment starting with...Ch. 20 - Prob. 13PDQCh. 20 - Prob. 14PDQCh. 20 - You have recovered a cloned DNA segment from a...Ch. 20 - Prob. 16PDQCh. 20 - Although the capture and trading of great apes has...Ch. 20 - Prob. 18PDQCh. 20 - Prob. 19PDQCh. 20 - Prob. 20PDQCh. 20 - Traditional Sanger sequencing has largely been...Ch. 20 - How is fluorescent in situ hybridization (FISH)...Ch. 20 - What is the difference between a knockout animal...Ch. 20 - Prob. 24PDQCh. 20 - When disrupting a mouse gene by knockout, why is...Ch. 20 - Prob. 26PDQCh. 20 - Prob. 27PDQCh. 20 - As you will learn later in the text (Special...Ch. 20 - The gel presented here shows the pattern of bands...Ch. 20 - A widely used method for calculating the annealing...Ch. 20 - Most of the techniques described in this chapter...Ch. 20 - In humans, congenital heart disease is a common...Ch. 20 - The U.S. Department of Justice has established a...Ch. 20 - Prob. 34ESP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- From your knowledge about DNA microarray, answer the following: A- How DNA microarray is created? and why it is referred to as “hybridization technology”? B- Why RT-PCR is important in the sample preparation to perform expression microarray experiment? C- Mention the name and the color of the dyes used in expression microarray? D- If the expression microarray experiment was done with a normal sample and a suspected sample, after reading the color pattern resulted from the experiment it was recorded that “gene A22” is expressed in the suspected sample. The gene A22 is clinically linked to colon cancer. Answer the following: What is the expected color of the spot on the microarray which represents this gene? What is your interpretation of the suspected sample; is it a cancer sample or not and explain why?arrow_forwardMicroarray hybridization is used mostly in transcript profiling or assaying DNA variation. Although the technology for establishing DNA microarrays was developed only recently, numerous applications have already been developed and their impact on future biomedical research and diagnostic approaches is expected to be profound. Give some examples of the practical use of this technique.arrow_forwardDiscuss the concept of the use of DNA in genome identification.arrow_forward
- Living modified organism (LMO) is defined as any living organism that possesses a novel combination of genetic material obtained through the use of modern biotechnology. Two LMOs that have obtained approval from FDA to be commercialized are the Hawaiian 'Rainbow' papayas and the AquAdvantage salmons. Discuss the advantages of Hawaiian 'Rainbow' papayas and the AquAdvantage salmons over their respective wild type.arrow_forwardTopic: Recombinant pharmaceuticals (for the production of insulin, human growth hormone or blood clotting factors) Question Describe the molecular genetics process using proper scientific terminology. Describe the steps that are involved. How is it performed?arrow_forwardIdentify 2 or more DNA-based technologies and discuss their combined applications in generating/developing a DNA marker system. You can cite an existing DNA marker for illustration (but not required). Here are the following DNA-based technologies: - DNA Replication and PCR - Restriction Enzymes and Digest - Nucleic acid electrophoresis - Southern Blot and Hybridization - DNA sequencingarrow_forward
- Briefly outline the steps of DNA extraction as carried out in a lab for the purposes of sequencing, with reference to a published protocol from a company supplying reagents and kits, noting the refinements compared to the protocol used in the online practical. Include the weblink you used.arrow_forwardexplain the ethical concerns for this biotechnology method (sanger sequencing)arrow_forwardDiscuss at least three methods of DNA extraction and summarize each methods using a schematic diagram.arrow_forward
- Discuss the principles , uses, advantages and disadvantages of illumina sequencing methodarrow_forwardHi, I would like to know which program is used for the graphical presentation of the results of a meta-analysis of genome-wide linkage scans?arrow_forwardExplain how the percentage efficiency of a real-time PCR reaction is determined using a theoretical experiment and why this is essential in any real-time PCR analysis.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
DNA Use In Forensic Science; Author: DeBacco University;https://www.youtube.com/watch?v=2YIG3lUP-74;License: Standard YouTube License, CC-BY
Analysing forensic evidence | The Laboratory; Author: Wellcome Collection;https://www.youtube.com/watch?v=68Y-OamcTJ8;License: Standard YouTube License, CC-BY