Brock Biology of Microorganisms (15th Edition)
15th Edition
ISBN: 9780134261928
Author: Michael T. Madigan, Kelly S. Bender, Daniel H. Buckley, W. Matthew Sattley, David A. Stahl
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 21.7, Problem 1CR
Summary Introduction
Higher concentration of Mercury ion (Hg2+) and Methylmercury (CH3Hg+) are very toxic to both macroorganisms and microorganisms. Many gram-positive and gram-negative bacteria can convert these toxic forms to relatively less toxic or non-toxic forms. Mercury resistant bacteria use enzyme organomercury lyase to degrade toxic form such as CH3Hg+ to Hg2+ and methane. These bacteria also employ the use of enzyme mercuric reductase to reduce Hg2+ to Hg0.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
explain please: Spike-Driven Syncytia Formation Is Coupled to S20 Fragment Generation in the Presence of ACE2. To investigate the functional and biochemical signatures of spike (S) protein upon engaging its receptor ACE2 in live cells, we first utilized a cell–cell fusion assay to obtain potentially cleaved spike protein products from syncytia . In this system, HEK293T cells transfected with plasmids encoding WT spike readily formed syncytia after coculturing with HEK293T cells expressing human and Vero E6-ACE2, as well as colorectal adenocarcinoma Caco-2 and lung adenocarcinoma Calu-3 cells expressing endogenous ACE2. We then collected these adherent syncytia and immunoblotted for cleaved spike species using a rabbit polyclonal antibody specifically detecting the S2 ectodomain through standard reducing Tris-glycine sodium dodecyl sulfate polyacrylamide gel electrophoresis. This experiment revealed that spike expression in HEK293T cells displayed full-length S and autocleaved S2…
5
5
S
6
5
5
5
6 U
6
U
6
5:14 PM | 0.2KB/s
HHHHH
R
R
U
RUUR ARU
AP
AP
R
U
U
R
R
AP
R
R
R
AP
MOLECULAR...GENETICS.
Describe gene regulation at transcription level.
Explain the role of antsense RNA in control mechanism.
Describe translational control mechanisms.
Describe common DNA damages.
Distinguish excision and mismatch repair.
Describe the role of recA protein in recombination repair
Elaborate on SOS repair mechanism.
Define thymine dimer. How are they formed and repaired?
Describe the molecular basis of mutation.
11
Leu+
Met+
Arg+
Write a detailed note on spontaneous mutation.
Explain about mutant detection methods.
Define reverse mutation. Describe the mechanism underlying Intragenic and
intergenic suppressor mutations
Describe the transposition mechanisms.
13
Vo
LTE
UNIT IV
Time (Min)
Describe the process of generalised transformation occurring in bacterial
chromosome and plasmid.
Elaborate on molecular mechanism and significance of transformation
22
Describe the process of…
(11) If you design a gRNA with the sequence, GGU AUC AUU GCA CUG ACC AG, in theory which
position of the nucleotide in the genomic DNA sequence below will be cut by Cas9 protein, which may
lead to a knockout due to an error in DNA repair? The starting and the end coordinate positions of the
DNA fragment on the chromosome are indicated at the beginning and end of the sequence,
respectively.
110,001 ATC GGT ATC ATT GCA CTG ACC AGA GGC TAC 110,030
A) Between 110,023 (G) and 110,024 (A)
B) Between 110,021 (C) and 110,022 (A)
C) Between 110,020 (C) and 110,021 (C)
D) Between 110,009 (C) and 110,010 (A)
Chapter 21 Solutions
Brock Biology of Microorganisms (15th Edition)
Ch. 21.1 - How is new organic matter made in nature?Ch. 21.1 - In what ways are oxygenic photosynthesis and...Ch. 21.1 - What is a methane hydrate?Ch. 21.1 - The oxygen and carbon cycles are interconnected...Ch. 21.2 - Why does Syntrophomonas need a partner organism in...Ch. 21.2 - Prob. 2MQCh. 21.2 - What is the final product of acetogenesis?Ch. 21.2 - Prob. 1CRCh. 21.3 - What is nitrogen fixation and why is it important...Ch. 21.3 - Prob. 2MQ
Ch. 21.3 - How does the compound nitrapyrin benefit both...Ch. 21.3 - The principal form of nitrogen on Earth is N2,...Ch. 21.4 - Is H2S a substrate or a product of the...Ch. 21.4 - Prob. 2MQCh. 21.4 - Prob. 3MQCh. 21.4 - Bacteria play major roles in both the oxidative...Ch. 21.5 - In what oxidation state is Fe in Fe(OH)3? In FeS?...Ch. 21.5 - Prob. 2MQCh. 21.5 - Why is excreted organic matter important to many...Ch. 21.5 - Prob. 1CRCh. 21.6 - How does the formation of CaCO3 skeletons by...Ch. 21.6 - Prob. 2MQCh. 21.6 - Prob. 1CRCh. 21.7 - What forms of mercury are most toxic to organisms?Ch. 21.7 - Prob. 2MQCh. 21.7 - Prob. 3MQCh. 21.7 - Prob. 1CRCh. 21.8 - What is the greenhouse effect and what causes it?Ch. 21.8 - What is the fate of most nitrogen used in...Ch. 21.8 - Why are the OMZs expanding and what are the likely...Ch. 21.8 - Prob. 1CRCh. 21 - Compare and contrast the carbon, sulfur, and...Ch. 21 - 14C-labeled cellulose is added to a vial...Ch. 21 - Prob. 3AQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In the treatment of acquired immunodeficiency syndrome (AIDS), a possible mode of therapy is to inhibit the reverse transcriptase (RT) of the human immunodeficiency virus (HIV), whcih is required for the retrovirus to be propogated by RNA-directed DNA synthesis. In the figure below, one of the substrates for RT is thymidine; and two drugs, AZT and HBY097 are known to inhibit HIV RT> (a) Thymidine; (b) AZT; (c) HBY097 Look at the structures and predict the type of inhibition (i.e. competitive or non-competitive) likely to be shown by each drug. By using knowledge on enzyme, plan an experiment that would enable you to confirm the type of inhibition by investigating enzyme kinetics and explain how you would interpret the results.Remarks: Not more than 250 words.arrow_forwardConsider the following simple regulatory pathways. Assume the full pathway is shown. A- E- B- F- C- G- D- 1 H- A You identify several null mutations (a complete deletion of the gene). For each mutant (ind with a - sign), determine whether the final product (I, J, K or L) is inducible, uninducible, or constitutive. 2 B 3 C 4 D inducible inducible constitutive uninducible constitutive inducible inducible E uninducible F G H > > >arrow_forwardPoint mutations in multiple tumor suppressor proteins have been linked to cancer. For example changes in the gene for adenomatous-polyposis-coli protein (APC gene) may result in colorectal cancer. Consider the following DNA sense strand. 3'-TAC CGG TTG TGA AGC TGA ATC-5' (i) (ii) (iii) (iv) Derive the mRNA molecule from the given DNA strand sequence above, paying attention to the polarity of the molecule. Write down the polypeptide chain sequence arising from the mRNA molecule of the question above, using the table of the genetic code (Table Q1 overleaf) and indicate the C- and the N-terminus of the peptide chain. Point mutations of a cytosine (C) often lead to the dysfunction of the APC protein. Write down all possible polypeptide chains that can result from all possible DNA mutations of cytosines, disregarding a mutation in the MET/START and STOP codons. I Specify which of the point mutations identified in (d) are redundant?arrow_forward
- Give typing answer with explanation and conclusion a) List three eukaryotic gene expression mechanisms that do not occur in prokaryotes. For two of these, give specific examples and the functional outcomes. b) Describe what is meant by the term “RNA silencing”. c) Using diagrams, give two examples of RNA silencing mechanisms and indicate one difference.arrow_forward(c) By binding one L-tryptophan molecule/monomer, the trp repressor binds to DNA to suppress syn- thesis of L-tryptophan in E. coli. Below is the amino acid sequence of the helix – (reverse) turn – helix region of the trp repressor that binds to DNA compared to the sequence of the corresponding DNA binding motif of the Prl protein, a different type of repressor protein. A diagram of the trp repressor dimer is also shown. reverse turn trp helix 4 70 Trp -Gly-Glu-Met-Ser-Gln-Arg-Glu-Leu-Lys-Asn-Glu-Leu-Gly-Ala-Gly- Ile- Prl -Ser-Glu-Glu-Ala-Lys-Glu-Glu-Leu-Ala-Lys-Lys-Cys-Gly-Ile-Thr- Val- Pri heilix trp helix 5 80 90 Trp Ala-Thr-Ile-Thr-Arg-Gly-Ser sgn-Ser-Leu-Lys-Ala-Ala- Prl Ser-Gln-Val-Ser-Asn-Trp-Phe-Gly-Asn-Lys-Arg-Ile-Arg- Prl helixarrow_forwardConsider the following simple regulatory pathways. Assume the full pathway is shown. A- E- B- F- C- G- D- 1 A H- 2 B || L You identify several null mutations (a complete deletion of the gene). For each mutant (indicated with a - sign), determine whether the final product (I, J, K or L) is inducible, uninducible, or constitutive. 3 C 4 D inducible inducible constitutive uninducible constitutive inducible inducible E uninducible F G H > I > J Karrow_forward
- 1. (a) By binding one L-tryptophan molecule/monomer, the trp repressor binds to DNA to sup- press synthesis of L-tryptophan in E. coli. Below is the amino acid sequence of the helix - reverse turn - helix region of the trp repressor that binds to DNA compared to the sequence of the corresponding DNA binding motif of the Prl protein. A diagram of the trp repressor dimer is also shown. Trp Prl Trp Prl 80 -Gly-Glu-Met-Ser-Gln-Arg-Glu-Leu-Lys-Asn-Glu-Leu-Gly-Ala-Gly-Ile- -Ser-Glu-Glu-Ala-Lys-Glu-Glu-Leu-Ala-Lys-Lys-Cys-Gly-Ile-Thr-Val- trp helix 5 70 trp helix 4 Prl helix 80 Prl helix Ala-Thr-Ile-Thr-Arg-Gly-Ser-Asn-Ser-Leu-Lys-Ala-Ala- Ser-Gln-Val-Ser-Asn-Trp-Phe-Gly-Asn-Lys-Arg-Ile-Arg- reverse turn 90 Comparing the two protein sequences above, identify all amino acid pairs that differ in electrostatic charge due to proton dissociable groups (assume pH 7). Indicate the charge of both residues for each such pair. (b) Circle the pair of residues for which the electrostatic charge due to…arrow_forwardConsider the following simple regulatory pathways. Assume the full pathway is shown. A- E- B- F- C- G- D- 1 A H- 2 B || L You identify several null mutations (a complete deletion of the gene). For each mutant (indicated with a - sign), determine whether the final product (I, J, K or L) is inducible, uninducible, or constitutive. 3 C 4 D- [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] E [Choose ] F G I H || J Karrow_forward1. Certain proteins that stimulate expression of a gene bind to DNA in a sequence specific manner and also induce conformational changes in the DNA. Describe the purpose of thses two modes of interaction with the DNA. 2. Draw the structures of the amino acid side chains that correspond to the following histone modification: a) acetylation of lysine; b) phosphorylation of serine; c) phosphorylation of histidine. How do thses modifications change the character of their respective side chain?arrow_forward
- Consider the structure of Cro repressor protein from bacteriophage lambda E. It is a DNA binding protein, and like many sequence- specific DNA binding proteins, it must function as a homodimer Ex. Notice the mutual docking of a phenylalanine residue from each subunit into a hydrophobic pocket of the partner subunit. These hydrophobic interactions are required for dimerization. The noncovalent interactions highlighted in yellow are also required for dimerization. These interactions represent examples of: Osecondary structure O tertiary structure O quaternary structure O secondary AND quaternary structure Ⓒ tertiary AND quaternary structurearrow_forward. All mutations that abolish function of the Rho termination protein in E. coli are conditional mutations;no cells with null mutations of the Rho-encoding genehave ever been isolated. What does this tell you aboutthe rho gene and its product?arrow_forwardIf the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individualarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license