Biology: Life on Earth with Physiology (11th Edition)
11th Edition
ISBN: 9780133923001
Author: Gerald Audesirk, Teresa Audesirk, Bruce E. Byers
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 31.5, Problem 1CSC
Summary Introduction
To describe:
Wildlife corridor, include private land and interspersed between national parks and national forests, can landowners preserve wildlife habitat while still making a living and enjoying their land.
Introduction:
Wildlife corridors allow the movement of animal in protective manner from one place to another place. It is important because it allow animals to maintain their habitat and genetic diversity. These corridors interspersed between private land and national parks and forest so it is taking some space of private land but, an individual can make different way, for example they can make bridges or underground subway so that animal can pass without any disturbance.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Bighorn sheep are an iconic species in the western United States, however, their
population size is drastically lower than it once was historically. These sheep inhabit
montane patches surrounded by urban and agricultural landscapes. Accordingly,
bighorn sheep can be considered a metapopulation. Wildlife managers would like to
increase the patch occupancy of bighorn sheep. Which of the following would be the
most effective conservation/restoration strategy?
None of these statements is an effective conservation strategy.
O Increase patch size and quality, and decrease the distance between patches.
O Increase patch size and the distance between patches, and decrease patch
quality.
O Increase the distance between patches and patchy quality, and decrease patch
size.
Decrease patch size, distance between patches, and patch quality.
Name two reasons that a large national park like Serengeti or Yellowstone might not be enough to effectively conserve a population of a threatened species. What solutions exist to address these reasons?
In 1970 the deer population of an island forest reserve about 518 square kilometers in size was about 2000 animals. Although the island had excellent vegetation for feeding, the food supply obviously had limits. Thus the forest management personnel feared that overgrazing might lead to mass starvation. Since the area was too remote for hunters, the wildlife service decided to bring in natural predators to control the deer population. It was hoped that natural predation would keep the deer population from becoming too large and also increase the deer quality (or health), as predators often eliminate the weaker members of the herd. In 1971, ten wolves were flown into the island. The data collected during this program are shown in the following table. The Population Change is the number of deer born minus the number of deer that died during that year. Fill in the last column for each year. The first has been calculated for you. Then graph the deer and wolf populations on the graph below.…
Chapter 31 Solutions
Biology: Life on Earth with Physiology (11th Edition)
Ch. 31.1 - describe the goals of conversation biology?Ch. 31.1 - Prob. 2CYLCh. 31.2 - Prob. 1CSCCh. 31.2 - describe the major categories of ecosystem...Ch. 31.2 - Prob. 1TCCh. 31.2 - Prob. 2CYLCh. 31.3 - define mass extinction?Ch. 31.3 - Prob. 1HYEWCh. 31.3 - explain why biologists fear that a mass extinction...Ch. 31.4 - Prob. 1CSC
Ch. 31.4 - Prob. 1CYLCh. 31.4 - Prob. 1TCCh. 31.4 - Prob. 2CYLCh. 31.5 - Prob. 1CSCCh. 31.5 - Prob. 1CYLCh. 31.5 - Prob. 1TCCh. 31.5 - Prob. 2CYLCh. 31.6 - Before 1700, wolves roamed over almost all of...Ch. 31.6 - describe the principles of sustainable...Ch. 31.6 - In 1970, Atlantic leatherback sea turtle...Ch. 31.6 - explain how population, technology, and lifestyle...Ch. 31 - List some reasons that the ecological footprints...Ch. 31 - Prob. 1FIBCh. 31 - A factor that increases humanity ecological...Ch. 31 - Prob. 1RQCh. 31 - Search for and describe some examples of habitat...Ch. 31 - Prob. 2FIBCh. 31 - Prob. 2MCCh. 31 - What is ecological economics? Why is it important?Ch. 31 - Prob. 3FIBCh. 31 - Prob. 3MCCh. 31 - Prob. 3RQCh. 31 - Prob. 4FIBCh. 31 - Prob. 4MCCh. 31 - Prob. 4RQCh. 31 - The smallest population of a species that is...Ch. 31 - Which of the following is not true of a population...Ch. 31 - Why are efforts to protect monarch butterflies a...Ch. 31 - A Native American saying tells us that We do not...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In 1970 the deer population of an island forest reserve about 518 square kilometers in size was about 2000 animals. Although the island had excellent vegetation for feeding, the food supply obviously had limits. Thus the forest management personnel feared that overgrazing might lead to mass starvation. Since the area was too remote for hunters, the wildlife service decided to bring in natural predators to control the deer population. It was hoped that natural predation would keep the deer population from becoming too large and also increase the deer quality (or health), as predators often eliminate the weaker members of the herd. In 1971, ten wolves were flown into the island. The data collected during this program are shown in the following table. The Population Change is the number of deer born minus the number of deer that died during that year. Fill in the last column for each year. The first has been calculated for you. Then graph the deer and wolf populations on the graph below.…arrow_forwardHunting is banned in all national parks but not outside of them. During bear hunting season, conservation officers conduct routine checks. One day, the OPP receive a report from campers that they heard shots fired inside Algonquin National Park. The OPP transmits this information to the Natural Resources office. Based on the campers' tip, check points are set up on the highway through Huntsville. All of the hunters that bring bears past the checkpoint have licenses, but in order to check out the camper's story several hairs are pulled from each carcass for DNA checks. The data below shows DNA containing two STR regions for the bear carcasses that were examined on the day after the campers' complaint, and two known reference samples of bear sub-populations around Huntsville, including inside the park. POSSIBLE POACHER'S DNA DATA Reference #1: Genotype Indigenous to Park TCAGGGACGACGACGACGACGACGACCCATTATCGGAGTTATTATTAGATCGATCCATTCGGATCGGATAT Reference #2: Genotype Indigenous to Park…arrow_forwardDescribe two of the threats facing native species at Hakalau Forest NWR or elsewhere in Hawai‘i, and two actions people have taken to address these threats. What new trend is now jeopardizing some of these efforts? What steps do you think might be required in the future to safeguard native species, populations, and communities in mountainous habitats in places like Hawai‘i?arrow_forward
- In many cases, circumstances prevent preservation of a large, unbroken area of a threatened species’ habitat. Sometimes, however, several smaller areas can be protected. In such cases, conservation biologists stress that the small areas must be linked by corridors of the appropriate habitat. Can you explain why?arrow_forwardEnvironmental scientists David Pimentel, Rodolfo Zuniga, and Doug Morrison of Cornell University reviewed scientific estimates for the economic and ecological costs imposed by introduced and invasive species in the United States. They found that, as of 2005, approximately 50,000 species had been introduced in the United States and that these accountedfor over $120 billion in economic costs each year. These costs include direct losses and damage, as well as costs required to control the species. (The researchers did not quantify monetary estimates for losses of biodiversity, ecosystem services, and aesthetics, which they said would drive total costs several times higher.) Calculate values missing from the table to determine the number of introduced species of each type of organism and the annual cost that each imposes on our economy. Of the 50,000 species introduced into the UnitedStates, half are plants. Describe two ways in whichnon-native plants might be brought to a new location.How…arrow_forwardWhat are the implications of the "bottleneck effect" for wildlife managers who try to help endangered species, such as the whooping crane, recover from near extinction?arrow_forward
- A large protected area is set aside to aid in the maintenance of an endangered cheetah population. The population of cheetahs in this area increases by 30 percent over the next ten years. Then, a highway is built through the middle of the protected area. In the following ten years, the cheetah population declines by 20 percent. This suggests that the highway acted as a corridor, allowing cheetahs to move out of the area. cheetahs fare best in a very large protected area. cheetahs are undergoing a natural population cycle.arrow_forwardExotic or non-indigenous species are species that have been transported to new locations by humans, either intentionally (e.g., the ornamental trade, fisheries or aquaculture) or unintentionally (e.g., accidental release of aquarium or pet species), and have established one or more populations in their new location. Exotic species may become invasive species if they expand their range in their novel region and become abundant. The presence of invasive species is of concern because invasive species can have negative effects on the affected ecosystems or commercial interest. Research an invasive species and include the following: Scientific name and common name (if the species has one) The species native region and invaded region Consequences or concerns that the species presents. Potential solutions Include referencesarrow_forwardWhich of the following best predicts the consequences of introducing brown rats ( invasive species) to an island where they did not previously exist? Choose 1 answer: Choose 1 answer: (Choice A) A The rat population size will likely remain small, and as a result the rats will not be able to outcompete other organisms for resources. (Choice B) B Without its typical food sources, the rat population will not be able to become established, and the island ecosystem will remain stable. (Choice C) The rat population will grow rapidly, disrupting the island's community structure by feeding on native plants and animals. (Choice D) D Without any natural predators, the rat population will become established and help increase the species diversity of the island answer explainarrow_forward
- Match the following solutions to examples that address problems for biodiversity. Ais-Richtersveld Transfrontier Park The Global wildlife program Haida Gwaii Watchmen Salmon recovery in Terra Nova National Park 1. Land managers have a responsibility to listen to local people's perspectives. 2. Conservation actions are difficult to coordinate between countries. 3. International organizations provide technical and financial support to developing countries. 4. Train and hire local people to work in protected areas.arrow_forwardThe ten-year cycles of the populations of the snowshoe hare and Canada lynx were first recorded from fur returns of Hudson's Bay Company traders in the late 1800s. The cycles revolve around the lynx's preference for hares over other animals as a food source. This predator-prey relationship is again being studied by the Northwest Territories Department of Renewable Resources, in an area known as the Mackenzie Bison Sanctuary. 1991 1992 N = 19 100 100 km N = 3 100 km 100 km Legend:a=I Lynx 1c. The density of the snowshoe hare in the study area was about 800/km2 in 1990 and about 100/km2 in 1991. Identify one possible cause for the change in the lynx population density during the 1991 to 1992 time period. d. After the decline in the hare population, younger male lynx were found to have migrated as far as 500 km from the study area. Explain how the gene pool of the neighbouring lynx populations would be affected. le. Lynx have lustrous, long hair. Currently lynx fur is out of fashion in…arrow_forwardThe ten-year cycles of the populations of the snowshoe hare and Canada lynx were first recorded from fur returns of Hudson's Bay Company traders in the late 1800s. The cycles revolve around the lynx's preference for hares over other animals as a food source. This predator-prey relationship is again being studied by the Northwest Territories Department of Renewable Resources, in an area known as the Mackenzie Bison Sanctuary. 1991 1992 N = 19 100 100 km N = 3 100 km 100 km Legend:a=I Lynx 1f. The birth rate in the lynx population can be estimated by determining litter sizes. Litter size can be determined by two methods. The first method involves counting the number of placental scars on the uterus of a lynx carcass. A scar is left at each implantation site of a fetus. The second method involves counting the number of degenerated corpora lutea (plural of corpus luteum) in the ovaries of the lynx carcass. Neither of these methods provides a completely accurate value for litter size.…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning