Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 7.5, Problem 1COMQ
Summary Introduction
Introduction:
The natural process of transformation that occurs in certain species of bacteria is called natural transformation. Genetics have untangled some of the steps for theprocess of transformation of bacterial cells by genetic material in their environment.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Match each enzyme name in the left column with the correct descriptive
phrase in the right column.
a. Topoisomerase II
b. DNA ligase
c. DNA polymerase y
d. Reverse transcriptase
i. Catalyzes most nucleotide incorporations
in bacterial DNA replication
ii. Cleaves RNA in a DNA-RNA hybrid
molecule
e. DNA polymerase I
f. DNA polymerase II
iii. Uses a tRNA primer in synthesis of
retroviral DNA
iv. Acts through an adenylylated DNA inter-
mediate
v. Catalyzes formation of a double-strand
DNA break
vi. Catalyzes mitochondrial DNA replication
_1. Bacterial proteins that have the ability to cut
both strands of the DNA molecule at certain points
2. Contain foreign DNA
3. Is made by connecting segments of DNA
from different sources
_ 4. General term for a carrier used to transfer
a foreign DNA fragment into a host cell
5. A small ring of DŇA found in a bacterial cell
6. The procedure for cleaving DNA from an
organism into small segments, and inserting the f. genetic engineering or
segments into another organism
a. recombinant DNA
b. vector
c. restriction enzymes
d. plasmid
e. transgenic organisms
recombinant DNA
technology
Defects in the excision repair process may result in :
A. Mutations
B. Okazaki fragments
C. Excess DNA polymerase activity
D. Shortened telomeres
Chapter 7 Solutions
Genetics: Analysis and Principles
Ch. 7.1 - 1. A form of genetic transfer that involves the...Ch. 7.2 - 1. A bacterial cell with an F factor conjugates...Ch. 7.2 - 2. Which of the following is a type of plasmid?...Ch. 7.3 - 1. With regard to conjugation, a key difference...Ch. 7.3 - 2. In mapping experiments, ______ strains are...Ch. 7.4 - Prob. 1COMQCh. 7.4 - Cotransduction may be used to map bacterial genes...Ch. 7.5 - Prob. 1COMQCh. 7.5 - Prob. 2COMQCh. 7.6 - 1. Which of the following is an example of...
Ch. 7 - 1. The terms conjugation, transduction, and...Ch. 7 - Prob. 2CONQCh. 7 - If you mix together an equal number of F+ and F...Ch. 7 - What is the difference between an F+ and an Hfr...Ch. 7 - 5. What is the role of the origin of transfer...Ch. 7 - 6. What is the role of sex pili during...Ch. 7 - Prob. 7CONQCh. 7 - Prob. 8CONQCh. 7 - Prob. 9CONQCh. 7 - 10. What is cotransduction? What determines the...Ch. 7 - Prob. 11CONQCh. 7 - Prob. 12CONQCh. 7 - Describe the steps that occur during bacterial...Ch. 7 - Prob. 14CONQCh. 7 - Prob. 15CONQCh. 7 - Antibiotics such as tetracycline, streptomycin,...Ch. 7 - Prob. 1EQCh. 7 - 2. In the experiment of Figure 7.1, Lederberg and...Ch. 7 - Explain how a U-tube apparatus can distinguish...Ch. 7 - Prob. 4EQCh. 7 - 5. In a conjugation experiment, what is meant by...Ch. 7 - In your laboratory, you have an F strain of E....Ch. 7 - 7. As mentioned in question 2 of More Genetic...Ch. 7 - An Hfr strain that is hisE+ and pheA+ was mixed...Ch. 7 - Acridine orange is a chemical that inhibits the...Ch. 7 - Prob. 10EQCh. 7 - Prob. 11EQCh. 7 - Lets suppose a new strain of P1 phage has been...Ch. 7 - If two bacterial genes are 0.6 minute apart on the...Ch. 7 - 14. In a cotransduction experiment involving P1,...Ch. 7 - Prob. 15EQCh. 7 - Prob. 16EQCh. 7 - 1. Discuss the advantages of the genetic analysis...Ch. 7 - Prob. 2QSDC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- 1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocityarrow_forwarda. Pfu Polymerase b.dNTPs c.Buffer Match each component above to the correct function(s) listed below. Write your selection(s) for each component. You may have more than one answer for each. 1. unwinds DNA 2. synthesizes new DNA strands 3. enzymatically catalyzes Quikchange 4. nucleotide source for new DNA strands 5. Energy source for reaction(s) 6. Repairs errors in base pair matching 7. Maintains pH and salt levels 8. Creates polymer chainsarrow_forward. 1 · | 2. L 3 | 4 | . 5 6 7 Direction: Encircle the letter of the correct answer . 1. It is a double-stranded , self replicating, circular DNA molecule present in bacteria which is widely used as a gene cloning vector. A. Cosmid B. Plasmid. C. Phagemid. D. Genome 2. In plant genetic engineering, which of the following acts as vector? B. Gene of interest D. Ti-plasmid А. Agrobacterium lumefaciens. Receipt plant cell. Which of the following illustrates breeding? A farmer choose a breed of cow for greater milk production The use of bacteria in order to produce human insulin. The insertion of cloned genes to plant cells. All of the above. 3. А. В. С. D. Being pest resistance is one of the traits that are being introduced to plants like corn and eggplant with the insertion of Bt-toxin gene to plant cell. What method is use when a gene is inserted to plants? A. Biolistic C. Plasmid insertion by heat shock treatment 4. B. Electroporation D. All of these 5. A biotechnologist wants to enhance…arrow_forward
- The general excision repair pathway for DNA repair has the following order A. endonuclease cuts → DNA ligase removes → endonuclease removes → DNA ligase B. DNA ligase → DNA polymerase → helicase or endonuclease removes → endonuclease cuts C. endonuclease cuts → helicase or endonuclease removes → DNA polymerase → DNA ligase D. endonuclease cuts → DNA polymerase repairs → helicase opens up → DNA ligasearrow_forwardWhich one of the following statements is true? a. Dideoxynucleotides signal the end of DNA replication in a cell b. None of the provided answers are true c. The DNA sequence determined by an autoradiogram should be identical to the template strand DNA sequence d. The probe hybridization solution used in the Sothern blot technique is approximately pH 10.0 e. The transfer buffer used in the Southern blot technique is approximately pH 7.0arrow_forwardTake each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication Complement of each strand ii. Transcribe the complement strand of DNA into an mRNA strand Translate the mRNA strand into an Amino Acid strand iii. a. ATGGACGTATAGATGACAGGTAGATGTTTCAGGGGGATTTATCGATAG b. ATGGCCATTGAGTGTCAAAAGTCTCAATGA First base U UUU UUC UUA UUG CUU CUC C CUA CUG G U -phenylalanine (Phe) -leucine (Leu) GUU GUC GUA GUG leucine (Leu) AUU AUC isoleucine (lle) Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Second base ACU ACC AUA ACA AUG methionine (Met) (start) ACG -valine (Val) UCU UCC UCA UCG CCU CCC CCA CCG GCU GCC GCA GCG C -serine (Ser) -proline (Pro) -threonine (Thr) -alanine (Ala) UAU UAC UAA stop UAG stop CAU CAC CAA CAG AAU AAC AAA AAG A -tyrosine (Tyr) GAU GAC GAA GAG - histidine (His) -glutamine (Gln) - asparagine (Asn) -lysine (Lys) -aspartic acid (Asp) -glutamic acid (Glu) CGU CGC CGA CGG AGU AGC AGA AGG G -cysteine…arrow_forward
- Which of the following one is liable for the conversion of covalently closed circular DNA to super coiled DNA of the plasmid? a.Exonuclease b. DNA Gyras c. Endonuclease d. Topoisomerasearrow_forward1. Scientists were able to develop transgenic bacteria that can be used for mercury remediation. This process involved combining genes for mercury resistance (so that the bacteria itself has protection) and mercury accumulation (thereby allowing the bacteria to sequester Hg for retrieval later on). They probably used the following techniques in creating the transgenic bacteria EXCEPT a. plasmids b. DNA ligase c. DNA polymerase d. restriction enzymes 2. Consider these two parents (Mom and Dad) and their son, Calvin. (see pic attached). Which two members of this family would show the greatest difference in their DNA profile?arrow_forwardRead the statements below and determine which f the recombination mechanisms that it matches with - there could be more than one match or there could be no match at all. For each box, place a YES or NO in the box. Statement 1. Donor cell produces a pilus in order to exchange DNA with recipient cell. 2. Mediated by a bacteriophage. 3. Always involves a plasmid. 4. Allows recombination of chromosomal DNA fragments from donor to recipient. 5. Requires rolling circle replication. 6. Requires donor to recipient cell direct contact. 7. Allows the uptake of free DNA fragments from the environment. 8. Is always horizontal gene exchange. 9. Allows movement of genes from a plasmid to a chromosome. 10. Requires a donor cell to infect a recipient cell in order for recombination to occur. 11. Involves plasmid integration into the chromosome prior to recombination. 12. Involves incorrect packaging of donor DNA into a phage particle in order for recombination to occur. 13. Involves DNA that was…arrow_forward
- Some antibiotic drugs fight infection by interfering with DNA replication, transcription, or translation in bacteria. Indicate whether each of the following antibiotic drug effects is on replication, transcription, or translation. HINT Each answer (replication, transcription, and translation) is used only once for the following: a. Rifampin binds to bacterial RNA polymerase. b. Streptomycin binds bacterial ribosomes, disabling them. c. Quinolone blocks an enzyme that prevents bacterial DNA from unwinding.arrow_forwardThe phrase 5to3 refers to the _________ . a. timing of DNA replication b. directionality of DNA synthesis c. number of phosphate groupsarrow_forwardMatch the following type of DNA repair mechanism with the most appropriate definition. Nucleotide excision repair Homologous recombination Base excision repair Nonhomologous end joining A. Repairs thymine dimers by removing a section of the strand B. Corrects damaged bases by removing only the base C. Repairs double strand breaks by joining the ends D. Repairs double strand breaks by copying second chromosomearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningEssentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:Cengage
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Essentials of Pharmacology for Health Professions
Nursing
ISBN:9781305441620
Author:WOODROW
Publisher:Cengage
genetic recombination strategies of bacteria CONJUGATION, TRANSDUCTION AND TRANSFORMATION; Author: Scientist Cindy;https://www.youtube.com/watch?v=_Va8FZJEl9A;License: Standard youtube license