Q: Explain and draw Haploid and diploid and heterokaryotic lifecycle of fungi.
A: Life Cycle of Fungi : Fungi life cycle involve formation of haploid spores and their germination to ...
Q: CAUSE: Large schools of Atlantic Cod were known to be in international waters off the coast of Canad...
A: There are few points about fishing technologies are as follows: fishing technology is one of the go...
Q: Two pea plants are crossed, which are purebred. A father is round, terminal, violet and wrinkled, wh...
A: Genetics is the science that deals with the inheritance of the genes or characters from one generati...
Q: Why are lymphoid tissues associated with the gastrointestinal tract and respiratory tissues?
A: Introduction :- Lymphoid tissues are well-organized tissues that help the immune system function. Pr...
Q: Compare the binding of MHC molecules to antigen with the binding of BCR to antigen.
A: The MHC(major histocompatibility complex) is a vast region of vertebrate DNA that contains a collect...
Q: describe the 3 main players in the GTPase cycle (GTPase, GAP, GEF)
A: Nucleic acid is a molecule that carries the information of the cell and expresses that information d...
Q: Gametes are formed in Select one: a. Mitosis b. Meiosis c. None of the above mentioned
A: Gametes are formed through meiosis (reduction division), in which a germ cell undergoes two fissions...
Q: Give a new example of transgenic organism wherein i can generate desired characteristics of that cer...
A: Transgenic organisms can be produced through various mechanisms such as Transformation, Transfection...
Q: Fill in the blanks in each sentence below after re-reading the section on Osmosis and Tonicity. Osmo...
A: Introduction :- The spontaneous net movement or diffusion of solvent molecules through a selectively...
Q: Describe what forensic pathologist is and the determination of the causes and manners of death in a ...
A: Introduction: Forensic pathology, forensic psychiatry, forensic dentistry, forensic radiology, and f...
Q: B. Make a punnet square for the following and give the phenotypic and genotypic ratio: 1. One homozy...
A: Answer 1:- A monohybrid cross is a breeding experiment between organisms of the P generation (paren...
Q: The green line is the isocline for species 1. The black line is the isocline for species 2. Populati...
A: The density of population fluctuates due to the following reasons; Natality (B): it refers to the nu...
Q: Describe the importance of biodiversity.
A: The phrase "biodiversity" refers to the great variety of life on Earth. The term "biodiversity" enco...
Q: Why is 80% ethyl alcohol is considered as the solvent of choice during phytochemical screening? What...
A: Note: As per Bartleby Guidelines, For Remaining Answers Please Repost The Question. Introduction: E...
Q: Required information 1Ab:1a B More A b and a B; and fewer A B and a b 1AB:1ab 1AB:1Ab:1 a B:1 ab Mor...
A:
Q: DDE vs Eggshell Thickness 1.28 1.24 1.2 1.16 - 1.12 3 7 9 11 DDE concentration in egg (ng/g) Shell t...
A: Q-1): In birds, the process of bone remodelling plays a vital role in maintaining bone calcium level...
Q: Fill in the blank with the most appropriate term that is described by the following statement: Close...
A: The components of DNA replication. A five-membered, oxygen-containing ribose sugar ring with three p...
Q: Which tree is deciduous? A. White Pine B. Blue Spruce C. Mahongany D. Evergreen
A: Deciduous trees are giant flowering plants. They include oaks, maples, beeches. Deciduous means "to ...
Q: Drag and drop the appropriate labels onto the cross section of the Cut Bank below the Highlevel/LRT ...
A: 6)River deposits. 5) vegetated berm 1)top soil(with brick)
Q: frequency of the wild type allele
A: Allele is one of two or more possible forms of a gene that are found at the same place on a chromoso...
Q: Which of the following gives the correct pathway for food as it moves through the digestive system? ...
A: The process of converting complex food substances to simple absorbable forms is called digestion and...
Q: Which of the following statements about cholesterol is TRUE? A. Cholesterol has a multiple carbon-ri...
A: Because the majority of the cholesterol molecule is non-polar, it forms connections with the phospho...
Q: From the previous question regarding the insertion of an A base into the template strand: will this ...
A: The transcription is the process of RNA synthesis from the DNA template. It is the first step of gen...
Q: When you add new tRNAs, what happens to the green amino acids they carry at the top of each tRNA?
A: In any cell the DNA ultimately form functional protein and for this every cell form a process called...
Q: n rats, black fur color is dominant to white fur color, and pointy ears are dominant to round ears. ...
A: Introduction: Law of independent assortment is based on dihybrid cross. It states that inheritance ...
Q: A new enzyme (protein) that helps protect a bacterial cell from reactive oxygen species (causing oxi...
A: INTRODUCTION Bacterial growth curve Represents number of living cells in a bacterial population over...
Q: 16. Lare specialized sphingolipid and cholesterol enriched microdomains within cell membrane. a. G p...
A: The plasma membrane is present in all living cells present in all living organisms that protects the...
Q: Introduction of nervous system:
A: Introduction of the nervous system: The nervous system is the major controlling, regulatory, and com...
Q: 1999 Question #2 Communication occurs among the cells in a multicellular organism. Choose three of t...
A: Introduction The cell is life's most fundamental structural and functional unit. Cells are the build...
Q: Size of wattle, Shank spur (+/0), Shape of hackles, Shape of saddles, Size of tail feathers, and Sha...
A: Introduction :- Drosophila melanogaster is a fly species in the Drosophilidae family (taxonomic orde...
Q: Assume that a single gene determines coat coloration in cats, with the B allele resulting in orange ...
A: A. What is the probability that Hobbes and Pepper have three kittens, Hopper (male), Pepsi (female),...
Q: Calories are a measure of the amount of fat in foods? A. True B. False
A: Lipids are heterogenous class of organic compound that are fatty acids or their derivatives and are ...
Q: Examples of strategies found in structures in the human body that serve to increase the surface area...
A: Ans C having folds.
Q: While performing a routine protein crystallization screening, you observe that one of your well drop...
A: Introduction The drop on the elevated platform, which is usually 2–10 µl, consists of half stock pro...
Q: In rats, black fur color is dominant to white fur color, and pointy ears are dominant to round ears....
A: Introduction The relationship between two gene variants is referred to as dominant. Each parent give...
Q: Use the picture below to answer the question. Coastal Bay Food Chain Algae Barracuda Damselfish Zoop...
A: The provided diagram describes the food chain of the coastal waters of Virginia. The food chain cons...
Q: How does application of recombinant DNA influenced the way in today's life? Answer comprehensively
A: Recombinant DNA technology is an important development in science that has made human life much easi...
Q: 4. When 2 people use the same dichotomous key to identify the same specimens, is it possible for the...
A: Introduction:- A dichotomous key is a method of identification whereby groups of organisms are divid...
Q: What type of fish scales regenerate fast? What type of aquatic environment they are in? Are they th...
A:
Q: Two alleles relate to melanin production A or a, where albinism is the expression of the recessive t...
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous chrom...
Q: Directions: Solve these genetic problems. Be sure to complete the Punnett square to show how you der...
A: The cross is made up of heterozygous and dominant individuals. They both had brown eyes. Because all...
Q: C. Solve these problems by listing the given genotypes, test crosses, genotypic and phenotypic ratio...
A: Serrated leaf is a dominant feature in plants that is represented by the genotype(Aa Aa) whereas smo...
Q: This case study is used to help illustrate the respiratory content you have been studying. It will a...
A: #Chronic bronchitis- This the long term inflammation of bronchi. This is common caused in chain smok...
Q: ee modes of dosage compensation exist in nature. riefly, describe the three different strategies. /h...
A: Males and females of several species have different sex chromosomes and in order to equalise their ...
Q: A mutation in which one nitrogenous base is substituted for another.. O never occurs in eggs or sper...
A: At a specific gene locus, a change in the typical DNA sequence. Although the term has a negative con...
Q: As the high-speed electrons knock out electrons and lose their energy when they hit the (+) target, ...
A: Introduction Electromagnetic waves are a form of radiation that includes X-rays. X-ray imaging is a ...
Q: Integral proteins are also known as Select one: a. Intrinsic proteins b. Glycosylated proteins c. Tr...
A:
Q: the processing of pre-mRNA in eukaryotes Select one: a. Exons are joined together using polyadenylat...
A: In Prokaryotes; both Transcription and translation process takes place in the cytoplasm; but in euka...
Q: 3. In people suffering from severe malnutrition, OP is often low because a lack of dietary amino aci...
A: Malnutrition is a condition of body in which the body lack nutrients that are important for maintain...
Q: In which of the following would the rate of blood flow be the lower? a vessel 1 millimeter in ...
A: 1 millimeter = 0.1 cm 1 cm 10 micrometer = 0.001 cm Decrease diameter means more of blood contra...
in your word, identify one difference one similarity between 16 S sequencing and metagenomic shotgun sequencing
Step by step
Solved in 2 steps
- In the following gel showing stained bands of the Alu insertion sequence, what is the genotype of individual 2? 941 bp 641 bp->>> 1 2 3 4 5 6 Homozygous for the 641 bp sequence that does not contain in the Alu insertion Heterozygous, containing one 941 bp sequence and one 641 bp sequence O Homozygous for the 941 bp sequence containing the Alu insertionSequencing reactions are done in separate tubes for each ddNTP with a radioactive primer. Which picture shows the correct 4 reactions after separation of the sequencing reaction by gel electrophoresis? (Hint: Primer sequence cannot be read from the gel.) Template: Primer: 5'-ATCGCTTACCATTAG-3' 5'-CTAAT-3' ddA ddC ddG ddT ddA ddC ddG ddT = — ddA ddC ddG ddT = A B O None of these figures A ddA ddC ddG ddT B C DShown below are several next-generation sequencing reads from a sample you have. Which of the following is the most likely candidate for the original linear piece of DNA present in the sample that created the sequence reads shown below? 5' GGGCATTA 3' 5' TACGAACA 3' 5' ATACCGGGC 3' 5' ACCGTACG 3' 5' AACATACC 3' Question 4 options: 5' ATTAACCGTACGAACATACCGGGC 3' 5' GGGCATTATACGAACAATACCGGGC 3' 5' ACCGGGCATTAACCGTACGAACAT 3' 5' AACATACCGGGCATTAACCGTACG 3' 5' GGCATTAACCGTACGAACATACCG 3' 5' ACCGTACGAACATACCGGGCATTA 3'
- In a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into a contig. Using the assembled sequence, perform a BLASTn search. Does the search produce sequences similar to your assembled sequence? 5’ TCGGGGTCCTGGGATCTCATCACTGCAGCGC 3’ 5’ACTGCAGCGCTTTCCCAGCGGGCGGTGGTAC 3’ 5’GGGCGGTGGTACTCGGGAAGTCAGGAGTGTT 3’ 5’AGGAGTGTTTAAAACCTGGGGACTGGTTTTG 3’ 5’TGGTTTTGGGGGCGCTGAAGGCAGCGCAGGA 3’Sequencing reactions are done in separate tubes for each ddNTP with a radioactive primer. Which picture shows the correct 4 reactions after separation of the sequencing reaction by gel electrophoresis? Template: Primer: 5'-ATCGCTTACCATTAG-3' 5'-CTAAT-3' ddA ddC ddG ddT ddA ddC ddG ddT = D ddA ddC ddG ddT A ddA ddC ddG ddT — B CDescribe the difference between Sanger based sequencing and Next Generation Sequencing (NGS). Why is NGS advantageous over Sanger based sequencing?
- How would you approach this problem? You plan to sequence the following DNA by Sanger sequencing. Your reaction includes your sequencing primer (5' is on the left) and template DNA (5' end is on the left), dNTPs, buffer, DNA polymerase and the following fluorescent ddNTPs: red ddGTP, green ddATP and blue ddTTP. Sequencing Primer: CCGCCGGGCCCCAT Template to be Sequenced: GAGCGGCGGGCTGAGTAGCTCGCCGCGGGGATGGGGCCCGGCGGATTCan you help with 1a please HELPFUL INFORMATION: When performing classical Sanger or "dideoxy" sequencing, you set up 4 parallel reactions per template to be sequenced from a specific primer, with each of the four reactions containing a different dideoxynucleotide, and then the four reactions were run in a separate, adjacent lanes on a gel. 1a. Why couldn't you combine all 4 dideoxynucleotides with the primer and the template and do the whole reaction in one tube, and then run the set of fragments produced by the reaction mixture on a single lane in an acrylamide gel?You learned in the chapter that an STR locus is a locus where alleles differ in the number of copies of a short, tandemly repeated DNA sequence. PCR is used to determine the number of alleles present, as shown by the size of the DNA fragment amplified. In the Figure below are the results of PCR analysis for STR alleles at a locus where the repeat unit length is 9 bp, and alleles are known that have 5 to 11 copies of the repeat. Given the STR alleles present in the adults, state whether each of the four juveniles could or could not be an off-spring of those two adults. Explain your answers.
- Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.Transcribe and translate the following DNA sequence (nontemplate strand): 5’-ATGGCCGGTTATTAAGCA-3’SANGER SEQUENCING NEXT GENERATION SEQUENCING WRITE A PRECISE AND ACCURATE DIFFERENTIAL REPORT ON THE ABOVE SEQUENCING TECHNIQUES.