Principles of Biology
2nd Edition
ISBN: 9781259875120
Author: Robert Brooker, Eric P. Widmaier Dr., Linda Graham Dr. Ph.D., Peter Stiling Dr. Ph.D.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 11, Problem 2CCQ
Summary Introduction
To analyze:
The phenomenon of RNA interference along with the ways by which RNA is processed during RNAi that lead to the silencing of a complementary mRNA.
Introduction:
MicroRNAs are the non-coding RNAs that are transcribed from endogenous eukaryotic genes. These genes are commonly found in the genome. They regulate gene expression especially during embryonic development in animals and plants.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
RNA silencing can be accomplished by specific MRNA degradation or by preventing its translation of the encoded protein. What specifically determines which of these
two pathways will be followed?
OIt depends on whether Drosha is involved in the process.
It depends on whether Dicer is associated with single- or double-stranded RNA.
It depends on whether the single-stranded RNA, associated with RISC, base-pairs perfectly or imperfectly with the target mRNA.
It depends on whether the RITS or the RISC complex associates with double-stranded RNA.
It depends on whether RISC initially binds to single- or double-stranded RNA.
OOO
Many uridine molecules are inserted into some mitochondrial mRNAs in trypanosomes. The uridine residues come from the poly(U) tail of a donor strand. Nucleoside triphosphates do not participate in this reaction. Propose a reaction mechanism that accounts for these findings. (Hint: Relate RNA editing to RNA splicing.)
One procedure of obtaining cDNA from mRNA is by using oligo(dT) primers. What are oligo(dT)s? Why does using them make sense based on the processing (or modification) of precursor mRNA to get mature mRNA?
Chapter 11 Solutions
Principles of Biology
Ch. 11.1 - Which of these binding interactions might be...Ch. 11.1 - Prob. 1TYKCh. 11.1 - When an ncRNA functions as a decoy, it contains...Ch. 11.2 - Prob. 1BCCh. 11.2 - Prob. 1CCCh. 11.2 - Prob. 1TYKCh. 11.3 - Prob. 1CCCh. 11.3 - Prob. 1TYKCh. 11.4 - Explain why RISC binds to a specific mRNA. What...Ch. 11.4 - The process of RNA interference may lead to the...
Ch. 11.4 - To catalyze the methylation of an rRNA, a snoRNA...Ch. 11.5 - Prob. 1BCCh. 11.5 - Prob. 1TYKCh. 11.6 - Prob. 1CCCh. 11.6 - Which of the following components are needed for...Ch. 11.6 - Prob. 2TYKCh. 11.7 - Prob. 1TYKCh. 11 - Which of the following types of molecules could...Ch. 11 - Prob. 2TYCh. 11 - Prob. 3TYCh. 11 - Prob. 4TYCh. 11 - Prob. 5TYCh. 11 - Prob. 6TYCh. 11 - Prob. 7TYCh. 11 - Prob. 8TYCh. 11 - Prob. 9TYCh. 11 - Prob. 10TYCh. 11 - An ncRNA may have the following funtions:...Ch. 11 - Prob. 2CCQCh. 11 - Prob. 3CCQCh. 11 - Review the concept of an RNA world described in...Ch. 11 - Prob. 2CBQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- RNA silencing can be accomplished by specific mRNA degradation or by preventing its translation of the encoded protein. What specific determines which of these two pathways will be followed? It depends on whether the RITS or the RISC complex associates with double-stranded RNA. It depends on whether the single-stranded RNA, associated with RISC, base-pairs perfectly or imperfectly with the target mRNA. It depends on whether Drosha is involved in the process. It depends on whether Dicer is associated with single- or double-stranded RNA. It depends on whether RISC initially binds to single- or double-stranded RNA.arrow_forwardDraw the SMN2 pre-mRNA (10 exons and 9 introns), indicate the 5’ and 3’ SS location. Draw the SMN2 mature mRNA before treatment with Spinraza. What type of alternative splicing is occurring? Draw the SMN2 mature mRNA after treatment with Spinrazaarrow_forwardWhat is mean by RNA editing ?arrow_forward
- Define RNA interference (RNAi).arrow_forwardWhat is the total size of the mature i.e. fully processed mRNA in nucleotides? How many amino acids would the encoded protein be? Assume that the N- terminal Met encoded by the AUG start codon, is NOT cleaved from the protein?arrow_forwardIf an antisense RNA is designed to silence the following mRNA sequence, which of the following antisense oligos (a-d) could be used for this purpose? mRNA sequence: 5' UAGGACUAUUAAGGUACACCCAUU 3' O 5' AUCCUGAUAAUUCCAUGUAAAUAA 3' O 5' AAUGGGUGUACCUUAAUAGUCCUA 3' O 5' UAGGACUAUUAAGGUACACCCAUU 3' O 5' UUACCCACAUGGAAUUAUCAGGAU 3¹arrow_forward
- Why and how does an antisense oligonucleotide functionally inactivate an mRNA for use in translation by a ribosome?arrow_forwardThe pioneer round of translation of an mRNA is very important to identify potentially dangerous mRNAs if per chance they possess aberrant in frame translational stop codons. Their detection leads to rapid degradation through the NMD pathway. What indications would the cell use to signal that an mRNA possesses an in frame stop following the pioneering read? Choose one. a) The mRNA has a shorter Poly A tail since it is not being efficiently translated b) If the cap binding protein is no longer associated with the cap it signals to the cell that the mRNA is no longer translatable. c) A stalled ribosomal complex on the mRNA is clearly detectable and since the translational machinery cannot initiate protein synthesis it is recognized as toxic and is degraded by the 26S proteasome. d) If the mRNA contains intron sequences then it is quickly recognized by the ribosomes as being abnornal and is degraded rapidly by the 26S proteasome. e) mRNA species that are still bound by key factors that…arrow_forwardA normal mRNA that reads 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ has an insertion mutation that changes the sequence to 5’ -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC– 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license