The inference from the given experiment. Introduction: In 1962, F. Chapeville and others reported an experiment in which they isolated radioactive C 14 -cysteinyl-tRNA Cys . They further removed the sulfur group from the cysteine and created alanyl-tRNA Cys . When alanyl-tRNA Cys was added to a synthetic mRNA, a polypeptide chain was synthesized containing alanine.

Question

Want to see more full solutions like this?

Answer 1

Question

Chapter 14, Problem 1NST

Summary Introduction

To determine: The inference from the given experiment.

Introduction: In 1962, F. Chapeville and others reported an experiment in which they isolated radioactive C¹⁴-cysteinyl-tRNA^Cys. They further removed the sulfur group from the cysteine and created alanyl-tRNA^Cys. When alanyl-tRNA^Cys was added to a synthetic mRNA, a polypeptide chain was synthesized containing alanine.

Expert Solution & Answer

Explanation of Solution

As per the given information, a polypeptide chain was synthesized containing alanine. This occurred after adding radioactively labeled alanyl-tRNA^Cys to a synthetic mRNA. From the given experiment, one can conclude that the amino acid is not involved in recognition of the codon.

Conclusion

Thus, from the given experiment, one can conclude that the amino acid is not involved in recognition of the codon.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Students have asked these similar questions

Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?

Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human β-globin gene (Shown in Figure 17.11) into bacterial cells, hoping the cells will express it and synthesize functional β-globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does β-globin made by a eukaryotic cell. Explain why.

You isolate an E. coli strain in which a mutation in the gene encoding the tRNAAla synthetase enzyme causes it to charge both tRNAAla and tRNACyS TRNAS with Alanine (Ala). You sequence the N-terminus of a protein, which normally has the sequence: Met-Cys-Ala-Thr-Tyr-- Which sequence(s) do you expect to obtain? Select one: O Met-Cys-Ala-Thr-Tyr---- O Met-Cys-Cys-Thr-Tyr---- O Met-Ala-Ala-Thr-Tyr---- O Met-Cys-Ala-Thr-Tyr---- + Met-Cys-Cys-Thr-Tyr---- O Met-Cys-Ala-Thr-Tyr---- + Met-Ala-Ala-Thr-Tyr----

Answer 2

Question

Chapter 14, Problem 1NST

Summary Introduction

To determine: The inference from the given experiment.

Introduction: In 1962, F. Chapeville and others reported an experiment in which they isolated radioactive C¹⁴-cysteinyl-tRNA^Cys. They further removed the sulfur group from the cysteine and created alanyl-tRNA^Cys. When alanyl-tRNA^Cys was added to a synthetic mRNA, a polypeptide chain was synthesized containing alanine.

Expert Solution & Answer

Explanation of Solution

As per the given information, a polypeptide chain was synthesized containing alanine. This occurred after adding radioactively labeled alanyl-tRNA^Cys to a synthetic mRNA. From the given experiment, one can conclude that the amino acid is not involved in recognition of the codon.

Conclusion

Thus, from the given experiment, one can conclude that the amino acid is not involved in recognition of the codon.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 3

Question

Chapter 14, Problem 1NST

Summary Introduction

To determine: The inference from the given experiment.

Introduction: In 1962, F. Chapeville and others reported an experiment in which they isolated radioactive C¹⁴-cysteinyl-tRNA^Cys. They further removed the sulfur group from the cysteine and created alanyl-tRNA^Cys. When alanyl-tRNA^Cys was added to a synthetic mRNA, a polypeptide chain was synthesized containing alanine.

Expert Solution & Answer

Explanation of Solution

As per the given information, a polypeptide chain was synthesized containing alanine. This occurred after adding radioactively labeled alanyl-tRNA^Cys to a synthetic mRNA. From the given experiment, one can conclude that the amino acid is not involved in recognition of the codon.

Conclusion

Thus, from the given experiment, one can conclude that the amino acid is not involved in recognition of the codon.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 4

Question

Chapter 14, Problem 1NST

Summary Introduction

To determine: The inference from the given experiment.

Introduction: In 1962, F. Chapeville and others reported an experiment in which they isolated radioactive C¹⁴-cysteinyl-tRNA^Cys. They further removed the sulfur group from the cysteine and created alanyl-tRNA^Cys. When alanyl-tRNA^Cys was added to a synthetic mRNA, a polypeptide chain was synthesized containing alanine.

Expert Solution & Answer

Explanation of Solution

As per the given information, a polypeptide chain was synthesized containing alanine. This occurred after adding radioactively labeled alanyl-tRNA^Cys to a synthetic mRNA. From the given experiment, one can conclude that the amino acid is not involved in recognition of the codon.

Conclusion

Thus, from the given experiment, one can conclude that the amino acid is not involved in recognition of the codon.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 5

Chapter 14, Problem 1NST

Summary Introduction

To determine: The inference from the given experiment.

Introduction: In 1962, F. Chapeville and others reported an experiment in which they isolated radioactive C¹⁴-cysteinyl-tRNA^Cys. They further removed the sulfur group from the cysteine and created alanyl-tRNA^Cys. When alanyl-tRNA^Cys was added to a synthetic mRNA, a polypeptide chain was synthesized containing alanine.

Expert Solution & Answer

Explanation of Solution

As per the given information, a polypeptide chain was synthesized containing alanine. This occurred after adding radioactively labeled alanyl-tRNA^Cys to a synthetic mRNA. From the given experiment, one can conclude that the amino acid is not involved in recognition of the codon.

Conclusion

Thus, from the given experiment, one can conclude that the amino acid is not involved in recognition of the codon.

Answer 6

Chapter 14, Problem 1NST

Summary Introduction

To determine: The inference from the given experiment.

Introduction: In 1962, F. Chapeville and others reported an experiment in which they isolated radioactive C¹⁴-cysteinyl-tRNA^Cys. They further removed the sulfur group from the cysteine and created alanyl-tRNA^Cys. When alanyl-tRNA^Cys was added to a synthetic mRNA, a polypeptide chain was synthesized containing alanine.

Expert Solution & Answer

Explanation of Solution

As per the given information, a polypeptide chain was synthesized containing alanine. This occurred after adding radioactively labeled alanyl-tRNA^Cys to a synthetic mRNA. From the given experiment, one can conclude that the amino acid is not involved in recognition of the codon.

Conclusion

Thus, from the given experiment, one can conclude that the amino acid is not involved in recognition of the codon.

Answer 7

Chapter 14, Problem 1NST

Summary Introduction

To determine: The inference from the given experiment.

Introduction: In 1962, F. Chapeville and others reported an experiment in which they isolated radioactive C¹⁴-cysteinyl-tRNA^Cys. They further removed the sulfur group from the cysteine and created alanyl-tRNA^Cys. When alanyl-tRNA^Cys was added to a synthetic mRNA, a polypeptide chain was synthesized containing alanine.

Answer 8

Expert Solution & Answer

Explanation of Solution

As per the given information, a polypeptide chain was synthesized containing alanine. This occurred after adding radioactively labeled alanyl-tRNA^Cys to a synthetic mRNA. From the given experiment, one can conclude that the amino acid is not involved in recognition of the codon.