Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 14, Problem 3CS
Summary Introduction
To determine: The information that could be needed to correct the mutation in the person’s own bone marrow cells.
Introduction: The medical techniques are developing at a very rapid rate. The genetic testing methods are used to detect the genetic defects in the zygote. Nowadays, the umbilical cord of the zygote is used to cure the genetic defects in the children. However, the medical experts are working on a method in which the mutations in the person’s own bone marrow cells could be correct.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
An individual carries a disease-causing point mutation. Briefly describe four methods that can be used to identify this mutation.
A couple with a child affected with DBA undergoes in vitro fertilization (IVF) and genetic testing of the resulting embryos to ensure that the embryos will not have DBA. However, they also want the embryos screened to ensure that the one implanted can serve as a suitable donor for their existing child. Their plan is to have stem cells from the umbilical cord of the new baby transplanted to their existing child with DBA, thereby curing the condition. What are the ethical pros and cons of this situation?
I understand that microarrays are being used to define the molecular
abnormality and the prognosis in some patients with leukaemia. What
are microarrays?
Chapter 14 Solutions
Concepts of Genetics (12th Edition)
Ch. 14 - Prob. 1NSTCh. 14 - A series of mutations in the bacterium Salmonella...Ch. 14 - HbS results from the substitution of valine for...Ch. 14 - Given that a faulty ribosomal protein is the...Ch. 14 - A couple with a child affected with DBA undergoes...Ch. 14 - Prob. 3CSCh. 14 - HOW DO WE KNOW? In this chapter, we focused on the...Ch. 14 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 14 - Contrast the roles of tRNA and mRNA during...Ch. 14 - Francis Crick proposed the adaptor hypothesis for...
Ch. 14 - During translation, what molecule bears the codon?...Ch. 14 - The chain of eukaryotic hemoglobin is composed of...Ch. 14 - Assuming that each nucleotide in an mRNA is 0.34...Ch. 14 - Summarize the steps involved in charging tRNAs...Ch. 14 - To carry out its role, each transfer RNA requires...Ch. 14 - What are isoaccepting tRNAs? Assuming that there...Ch. 14 - When a codon in an mRNA with the sequence 5-UAA-3...Ch. 14 - Discuss the potential difficulties of designing a...Ch. 14 - Prob. 13PDQCh. 14 - Prob. 14PDQCh. 14 - The synthesis of flower pigments is known to be...Ch. 14 - The study of biochemical mutants in organisms such...Ch. 14 - Explain why the one-gene: one-enzyme concept is...Ch. 14 - Why is an alteration of electrophoretic mobility...Ch. 14 - Prob. 19PDQCh. 14 - Prob. 20PDQCh. 14 - Prob. 21PDQCh. 14 - Prob. 22PDQCh. 14 - Several amino acid substitutions in the and ...Ch. 14 - Define and compare the four levels of protein...Ch. 14 - What are the two common types of protein secondary...Ch. 14 - How do covalent disulfide bonds, hydrogen bonds...Ch. 14 - Prob. 27PDQCh. 14 - List three different types of posttranslational...Ch. 14 - Prob. 29PDQCh. 14 - How does an enzyme function? Why are enzymes...Ch. 14 - Prob. 31PDQCh. 14 - Three independently assorting genes (A, B, and C)...Ch. 14 - How would the results vary in cross (a) of Problem...Ch. 14 - Deep in a previously unexplored South American...Ch. 14 - Many antibiotics are effective as drugs to fight...Ch. 14 - The flow of genetic information from DNA to...Ch. 14 - Prob. 37ESP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Although it is well known that X-rays cause mutations, they are routinely used to diagnose medical problems, including potential tumors, broken bones, and dental cavities. Why is this done? What precautions need to be taken?arrow_forwardWhich of the examples of genetic testing below are prognostic tests? Which are diagnostic? (a) Individual sequencing (personal genomics) identifies a mutation associated with Alzheimer’s disease. (b) ASO testing determines that an individual is a carrier for the mutant b@globin allele (bS) found in sickle-cell anemia. (c) DNA sequencing of a breast tumor reveals mutations in the BRCA1 gene. (d) Genetic testing in a healthy teenager identifies an SNP correlated with autism. (e) An adult diagnosed with Asperger syndrome (AS) has a genetic test that reveals a SNP in the GABRB3 gene that is significantly more common in people with AS than the general population.arrow_forwardA neutral mutation is, by definition, a mutation that does not result in the change of the encoded amino acid sequence of a gene. 1)True 2)Falsearrow_forward
- Bacteria are often the preferred hosts for genetic engineering projects by splicing in novel genes from eukaryotes into plasmids, which are moved into competent bacteria. For instance, the gene for human insulin was isolated and moved into a bacterium, which can now produce the much-needed chemical. Previously, type 1 diabetics had to rely on professionals that gathered insulin from human cadavers, cows, and pigs. In order for this feat of genetic engineering to occur, researchers had to start with an unspliced mRNA transcript for h insulin. Agree/Disagree? Explain your response.arrow_forwardGene mutations can be classified in two major ways:(1) hereditary or germline mutations that are inherited from a parent and are present throughout a person’s life in virtually every cell in the body.(2) acquired or somatic mutations that occur at some time during a person’s life and are present only in certain cells, not in every cell in the body.If there is no family history of a particular disease but a child has the disease then it may have arisen due to a(n) ________ mutation early during development. A) acquired B) inherited C) silent D) transitionarrow_forwardWhich of the following conditions is most likely to be successfully treated by gene therapy using a viral vector to deliver a wild-type copy of one gene that is present in mutant form in a person with the condition? Assume that the viral vector used has the ability to home to relevant target tissues. Also assume that the patient can be treated at a young enough age to avoid irreversible phenotypic impacts of the mutation described. Timothy Syndrome, a multi-system disorder characterized by dysmorphic features and autistic behavioral traits, caused by overexpression of calcium channel gene Cerebral adrenoleukodystrophy (ALD), a neurological disorder caused by a frameshift mutation knocking out the function of the ABCD1 gene encoding a lipid transporter Osteogenesis imperfecta caused by a dominant negative mutation in the collagen A1 gene Myopia (shortsightedness), a vision impairment with heritability estimates in the range of 0.6-0.8, where risk is impacted by at least 200 genesarrow_forward
- Discuss briefly the effects of colchicine treatment on cells. What are the genetic implications of such effects?arrow_forwardAn experiment was performed in mice. Wild-type bone marrow is used to reconstitute lethally irradiated Cr2-/- mice (wt®Cr2-/-), or vice versa (Cr2-/-®wt). As controls, Cr2-/- bone marrow is used to reconstitute Cr2-/- recipients (Cr2-/-®Cr2-/-), and wild-type bone marrow used to reconstitute wild-type recipients (wt®wt). These mice are then inoculated with the HSV-rd virus at 106 PFU, once at day 0 and then a second time at day 28, and the anti-HSV IgG responses are measured every 7 days, as shown in figure below. a) From the data shown above, on which cell type is the expression of the complement receptor most important for humoral immunity? b) For each of the cell types expressing the complement receptor encoded by Cr2, what is the explanation for their importance in humoral immunity to HSV inoculation?arrow_forwardWhat is the definition of Driver Mutations & Passenger Mutations? Also describe why each are informative in characterizing tumors.arrow_forward
- Using the information provided below, which of the individuals A and B have: i) Genotypic change ii) Phenotypic change iii) Genotypic and phenotypic change X is the partial CDNA sequence of the normal CFTR gene. Use this to determine which DNA sequence (A &B) is the DNA extracted from a patient with and without disease. X) ATGGCGGTCACTCGGCAATTTCCCTGGGCTGTACAAACATGGTATGACTCTCTTGGAGCAATAAACA Met. A V IR Q F P WA V Q T W Y D S L GAI .. A) ATGGCGGTCACTCGGCAATTTCCCTGGGCTGTACAAACAGGTATGACTCTCTTGGAGCAATAAACAA Met. B) ATGGCGGTCACTCGGCAATTTCCCTGGGCTGTACAAACTTGGTATGACTCTCTTGGAGCAATAAACA Met. Since this is a complementary DNA (CDNA) The nucleotide "T" can be directly replaced with U to get the mRNA strand. Example: ATG is AUG, TCA is UCA etc Second letter G UAU UCU c Phe UCc UGU UUC U UUA UAC JTyr UGCCYS Ser UCA UCG UAA Stop UGA Stop A UAG Stop UGG Trp UUG Leu G. CUU CCU CCC Pro CAU CAC Hi. CAA CAGJ CGU CGC CUC CUA Leu CCA Arg CGA Gin CUG CCG CGG AUU ACU ACC ACA AUG Met ACG LAsn AGUser AAC AUC…arrow_forwardHow does bisulfite treatment coupled with PCR enable the identification of DNA methylation? And, How could a Southern blot be used to determine if a given DNA sequence contains methylated CpGs in paper "Amyloid-β Alters the DNA Methylation Status of Cell-fate Genes in an Alzheimer's Disease Model." Taher, N., McKenzie, C., Garrett, R., Baker, M., Fox, N., & Isaacs, G. D. (2014). Amyloid-β alters the DNA methylation status of cell-fate genes in an Alzheimer’s disease model. Journal of Alzheimer’s Disease: JAD, 38(4), 831–844. https://doi.org/10.3233/JAD-131061arrow_forwardPinpointing a disease gene requires a combination of approaches. Mutations in the XIAP gene are known to cause a serious condition called X-linked lymphoproliferative disease (XLPD). In the case of XLPD, in which the blood contains too many lymphocytes (white blood cells of the immune system), crowding out the oxygen-carrying red blood cells and damaging the liver. When compairing the XIAP amino acid sequence of one affected patient to other human and animal standard RefSeq, the patient has an amino acid substitution at position 203, from cystenine (C) to tyrosing (Y). This evolutionary conservation suggests Group of answer choices that the standard RefSeq does not provide enough information to determine a possible cause of XIAP function. mutations in the XIAP gene and XLPD are not associated. that the mutation in the affected patient has no impact on XIAP function. that the mutation in the affected patient might alter XIAP function.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Serology 101: Testing for IgG and IgM antibodies; Author: Beckman Coulter Dx;https://www.youtube.com/watch?v=LtqKB-qpJrs;License: Standard youtube license