Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 17, Problem 15PDQ
Many promoter regions contain CAAT boxes containing consensus sequences CAAT or CCAAT approximately 70 to 80 bases upstream from the transcription start site. How might one determine the influence of CAAT boxes on the transcription rate of a given gene?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Many promoter regions contain CAAT boxes containing consensus sequences CAAT or CCAAT approximately 70 to 80 bases upstream from the transcription start site. How might one determine the influence of CAAT boxes on the transcription rate of a given gene?
Many eukaryotic promoter regions contain CAAT boxes with consensus sequences CAAT or CCAAT approximately 70 to 80 bases upstream from the transcription start site. How might one determine the influence of CAAT boxes on the transcription rate of a given gene?
The following logo plot represents the preferred cis-regulatory sequences (i.e.
transcription factor binding site) of bHLH transcription factor FOSL1.
C
1 2 3 4 5 6 7 8 9 10 11
position
Would you expect this sequence to be recognized by a monomer, a homodimer, or a
heterodimer of the protein? Explain your answer.
(short phrases are sufficient; please write your answer into the template below)
A-
В I
A -l expect FOSL1 to bind as a:
(monomer, homodimer, heterodimer; please choose)
B - short explanation:
information content (bit)
!!
Chapter 17 Solutions
Concepts of Genetics (12th Edition)
Ch. 17 - Cancer cells often have abnormal patterns of...Ch. 17 - The hormone estrogen converts the estrogen...Ch. 17 - Each year in the United States, there are over...Ch. 17 - Prob. 2CSCh. 17 - Each year in the United States, there are over...Ch. 17 - HOW DO WE KNOW? In this chapter, we focused on how...Ch. 17 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 17 - What features of eukaryotes provide additional...Ch. 17 - Provide a definition of chromatin remodeling, and...Ch. 17 - Describe the organization of the interphase...
Ch. 17 - A number of experiments have demonstrated that...Ch. 17 - Provide a brief description of two different types...Ch. 17 - Present an overview of the manner in which...Ch. 17 - Prob. 9PDQCh. 17 - Explain how the addition of acetyl groups to...Ch. 17 - Distinguish between the cis-acting regulatory...Ch. 17 - Prob. 12PDQCh. 17 - Describe the manner in which activators and...Ch. 17 - Compare the control of gene regulation in...Ch. 17 - Many promoter regions contain CAAT boxes...Ch. 17 - Prob. 16PDQCh. 17 - Prob. 17PDQCh. 17 - Many transcriptional activators are proteins with...Ch. 17 - Prob. 19PDQCh. 17 - DNA supercoiling, which occurs when coiling...Ch. 17 - Prob. 21ESPCh. 17 - Prob. 22ESPCh. 17 - Because the degree of DNA methylation appears to...Ch. 17 - A particular type of anemia in humans, called...Ch. 17 - Regulation of the lac operon in E. coli (see...Ch. 17 - DNA methylation is commonly associated with a...Ch. 17 - During an examination of the genomic sequences...Ch. 17 - Prob. 28ESPCh. 17 - Although a single activator may bind many...Ch. 17 - Hereditary spherocytosis (HS) is a disorder...Ch. 17 - Transcription factors play key roles in the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect would a point mutation at any one of the bolded and underlined nucleotides disrupt termination of transcription? Group of answer choices Mutation in one of these nucleotides would disrupt base pairing, preventing the formation of the hairpin and disrupting termination. Mutation in one of these nucleotides would have no affect on base pairing, so the termination hairpin is formed and termination proceeds. Mutation in one of these nucleotides would not disrupt base pairing, but would prevent the formation of the hairpin and disrupt termination. Mutation in one of these nucleotides would disrupt base pairing, but not affect the formation of the hairpin and termination proceeds.arrow_forward"Upstream" "Downstream" Exons Start of transcription Termination codon 5 3' Promoter initiator codon Introns Polyadenylation signal (intervening sequences) 5' untranslated region 3' untranslated region Direction of transcription Please study the diagram above on eukaryotic gene expression. In order to provide instructions for gene expression, a eukaryotic gene should have the following sequences except for O A. Promoter B. Start codon also known as initiator codon C. Splicing signals (dinucleotide sequence in the intron) O D. 5' CAP sequencearrow_forwardThe following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Is this terminator rho independent or rho dependent?arrow_forward
- Identify the statements that are features of a promoter. In prokaryotes, the promoter contains a −35 and −10 region upstream of the transcription start site. In prokaryotes, the promoter is recognized by general transcription factors (GTF), which recruit the RNA polymerase holoenzyme. In both prokaryotes and eukaryotes, the promoter is located in the 5' direction, upstream from the transcription start site. In eukaryotes, the promoter recruits the preinitiation complex, which includes the TATA-binding protein. In eukaryotes, the promoter attracts the small and large ribosomal subunits with the help of initiation factors.arrow_forwardThe consensus sequence for the –35 sequence of a bacterial promoter is 5′–TTGACA–3′. The –35 sequence of a particular bacterial gene is 5′– TTAACA–3′. A mutation changes the fifth base from a C to a G. Would you expect this mutation to increase or decrease the rate of transcription?arrow_forwardConsider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect would a point mutation at any one of the bolded and underlined nucleotides disrupt termination of transcription? Group of answer choices 1.Mutation in one of these nucleotides would disrupt base pairing, but not affect the formation of the hairpin and termination proceeds. 2.Mutation in one of these nucleotides would have no affect on base pairing, so the termination hairpin is formed and termination proceeds. 3.Mutation in one of these nucleotides would not disrupt base pairing, but would prevent the formation of the hairpin and disrupt termination. 4.Mutation in one of these nucleotides would disrupt base pairing, preventing the formation of the hairpin and disrupting termination.arrow_forward
- 4.1 Name and discuss two transcription regulatory elements that can be found in the figure. (6)4.2. During the activation of eukaryotic transcription the promoter region needs to be accessible for the binding of transcription factors. Describe in detail one of the mechanisms involved in this process.arrow_forwardA bacterial species has a hypothetical sigma promoter that has the following sequence: TTGGCA - 18 bases - TATAAT What change in the level of transcription would there be if the sequence was mutated to: TTCGCA -18 bases -TATAAT O The mutation would bind the promoter to the consensus and produce normal levels of transcription O The mutation would inhibit the promoter thereby inhibiting transcription The mutation would move the promoter away from consensus and reduce the level of transcription O No change the consensus TATAAT sequence in the same. D00 F3 F4 F5 F6 F7 F8 F9 % & 5 6 7 8 9 %24arrow_forwardThe interphase nucleus is a highly structured organelle with chromosome territories, interchromatin compartments, and transcription factories. In cultured human cells, researchers have identified approximately 8000 transcription factories per cell, each containing an average of eight tightly associated RNAP II molecules actively transcribing RNA. If each RNAP II molecule is transcribing a different gene, how might such a transcription factory appear? Provide a simple diagram that shows eight different genes being transcribed in a transcription factory and include the promoters, structural genes, and nascent transcripts in your presentation.arrow_forward
- For each of the following initiation factors, how would eukaryotic initiation of translation be affected if it were missing? A. eIF 2 B. eIF4 C. eIF5arrow_forwardThe following double-stranded DNA sequence is part of a hypothetical yeast genome which contains a very small gene. Transcription starts at the Transcription Start Site (TSS), proceeds in the direction of the arrow and stops at the end of the Transcription Terminator (green box). 5' 3' TSS CTATAAAAATGCCATGCATTATCTAGATAGTAGGCTCTGAGAAATTTATCTCACT | | | | | | | | | | GATATTTTTACGGTACGTAATAGATCTATCATCCGAGACTCTTTAAATAGAGTGA - 5' PROMOTER TERMINATOR 3' a) Which strand (top or bottom) is the template strand? Explain why. b) What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends. c) What is the sequence of the protein produced from the mRNA? d) If a mutation (an insertion) were found where a T/A (top/bottom) base pair were added immediately after the T/A base pair shown in red, what would be the sequence of the mRNA? What would be the sequence of the protein?arrow_forwardIntrons in protein-coding genes of some eukaryotes are rarely shorter than 65 nucleotides long. What might be a rationale for this limitation?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY